Saccharomyces_cerevisiae Locus Mono:0:snR56
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:0:snR56
Saccharomyces_cerevisiae
Mono:0:snR56
II
snR56
1001..1088
2088
GTCTAAAAAATCCTCCATTTCATGGCCAGGCCTTATGGCTTCTCTAGATTTGAAGTTTA
TTACTGTATAGTTTAAAGAATGTGCAGGATCATCTTCATTCTTGGCTTCCATTTTAGAAC
CTGCTTTTTGCAAGCTGGATTTTAGCAGCTCATTTTCTTGAACTGTGGTCATCGAAGAAT
CTACGTAAGAGAACTGGTTTTCATCTTTCCTTACTATCTTTCGGATTTTATCCATCTGCA
CAAACTCGGTAAGATTGTACCAGGTATCATCTTCGTCAATTTTCGGATAAGAAACCATCA
TCTGCCGTTCCTTGAAGTTGTGAACAATATTCTCGAATTTTGCGCCATCCCTTTCTTCCA
TCATTTTGTAAAGGCCATCTTTAGGATCATACTGAATGTAAAAGTTTCCCATTCTACAGT
CAAACCAGTAGCCATACCTCATGCTGGAATTATCTGCATGCTGAAAATGAATGACATGAA
CGTGTCCAATGGGGATGTCCTTGATTCCGTGAAATGGCTGATTCTCCTTGACATTAAAGG
AATACTGATCGATCCCTATAGTTACCTCAATCGGAGCAGATGTAAATGGTACAGTATTCA
TTGCAGGCTTCCGATATTTTATTTTTTAGCCCCATGTCCCAGCGATAAGGAGGATCTTTG
GTGTCCATTCATCTCATTAAACCCTAAACCATTGAAATATTCGTGTTCGTGCGTCGCGAT
TTTTTCCGCTTTCAAGATGTGTCCTTTCTTCATCTCTTGGTTCTTATAAAAGGGCGCCGC
AAACCCCTCCTAATTACTTTTTCCTTTTCACATCCCATGGGTTTTATCTTATACCAAATG
TTTACCATTCTGAATCGTATAGCCAACAAGTAACCACAGCTGCAATTGTGAAAAAAATTG
ATAGGTGTGGTCACCCAACTGTTTTTTTCTCTTTTTCTTTTTTTTTTTTTGAAATGGCTA
GACGGTGCTTTTGCTGGTAAAAGAAAAACTCTTGTTTCAATTTAACATGATGAAAAAATA
TATTAACACAGACCTGTACTGAACTTTTCGAAGTTTTGCAGATAACAATATTGCTTTTTT
TCTCTGACTTTAACTAATCGTTCTTATTTCTGTATATACTATGACCTTGCAAACCTTGAA
ATGCAAAATTCGTATTCTCTGCTAAATTGAAAAATTTAGAGCATGAAGTGTGTTTTCCAG
CAGACACCGCCTGTGAAAAAGATGGTAAAATGATATGATAATTAAACACACATAATAATA
GCATATATGATATATAAGACTATATGAAGAGATGAGGAGAAGAGAAGAAAAAATTGGTAG
TATTTTCATTTCATCTATTTCTTAGCAGTCAATCTTCTTAGGTAGAAAGCTAATTCTTCA
CCTTCCAAGATGTAACCATCACATCTACCGGATTGACCTGGTCTGGAAGAGATACAAGCG
TATAATCTACCGGCGCTGAATTGAGATTCAACGGAAGATTCGATCTTGGCAGAAGCAGCT
CTAGCAGCCCACTTTCTTTCAGCGTTCTTGCTCTTGGCAACAGTTTCTTCTTCCTTGACG
TTCTTCTTCTTACCCAAGGTTTGACCGTAGTGAGCTTCGAACCATTGTCTGAATGGAGTA
GCATCAATTTGGACAATGGCAGCCTTGGTCAAAGTGTTAGTTCTAACCAATTCATTGTTG
GATGGATGGTAAACAACACCAGCAATTCTGGTCTTCTTGGAGATACCTTCAGAAGCCCAA
GAAAAGTTACCGGTTTCAATTCTTAGAGCTCTGTATTTCTTGTTACCACCTCTAGTTCTA
ACAGAGTGAATTCTCTTAGCACCGATCTTGGTGTTGGCTGGTTGACGGCCTAATTCGAAC
TTTCTCTTCTTTCTGAATTGAGCACGCTTGGCACCGGTAGCGGATCTTTTGTGACGAGAA
TCACGAGAAATACCCATTTTGTAACTGTAATAGAAAATTTAATGACGCTTGTTAGTAAAA
TAAAGAACGTACAAAAGTTGCGGAATTTTTTTCTTATCTTGAAATATGCTTTGGTTTCTT
TTCATCTCTTCTTGTGAAAAACTCGGCGTTTCATAAGAGGCTTGATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved