Saccharomyces_cerevisiae Locus Mono:39:snR50
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:39:snR50
Saccharomyces_cerevisiae
Mono:39:snR50
XV
snR50
1001..1090
2090
TCAATAGATGGCGTGAGTACATTTAATCGAGCATCAACATCTCTTCCAGAATCATCAAC
AGACGACATCTCTCCACTACGCGAAGAAGGTAAGATTAATGTTCCTAAAAGAACGTCAAG
TAGAAAGATACTGTCTAAAAATTCAAGCAAAAAAAATGTACTGCCTGAACAGCAAACAAA
GCCAAGTGAAATATATCTGGATAAAGAAGCCTTACAAAGTTTTGTTCCCGTACTCTCTGT
CACAGAGGGTACTCATCGCATCAATCGCTCGTCGTTACAAACGCAATCTACCATCGGATT
ATGCATTACCAATTTAAGAAACAAAGAAGGCATGAAGCTCAATGCCAAGGAATACGTGGA
AATCCTGGCTCAGCAGCAACGCAAGGAAGATGAAAGGTATGCTGTTTTGGAAAGAAAATT
TGCATCTTGTAGATGGTGCAGTGATAAGGACCTGCAGTATTTGAAAAAGAAACGAATTTC
CATGAATAAGATATGGTCTGATTATGTCCGATTTTACCGTGGAAAGTTGAACAACCCATG
AAGGAAAAAGGTCTTGGCTATATATAACGGCAGACAAAATATAAGTATACACGTATATAT
GGTGGTAAACACGCATATACTGTATGCCATGTATTTACCATTACATAGTTATTTACGCAC
TCTATAAAAAGTTAACATTGCATTTTAATAAATTCCTTAAATTACTCTAATTAGGATGGT
AGCCCTACCTTTTTTTTTTTTTGGCAACACATGGTCAACTTTTCTTCTCATGCTTTAAAA
GGCGAGAAAAAATGAAAATTAGCAAAATGACCTTTCCCTCCTTCCCACATTGAATATATA
CACTGGAAGATATAAGCAACCAGTACTGTAGATAAAAAAGATCACTACGATATTCGTCGG
ACTCCAGTCGGAGTGCAGTGCCCGATTACTCTTAATTGCACGCATCGTGCCAAGTTTAAT
TGGTATTGCTCGAACATCTAGGAATAAGAGAAGGACTTACTTTAGAATGATGAAAGAGGT
AGCAATTTGCAGCAGATTTTTCGTGATTGAATCAAACAAAGATTAACCTTTACAGAACCG
CTACACTGATACTAATGTAAGAAACATTTCCTTTATTTTTTTTCTAGCCCGTAGTGTACT
CTTATAGTTTTGATATTTCCTTTCTATCTTTGTAAATGTAAATAATCACATTTGTCTGAC
AACACACTTGTTGCCACTAATTATTTCAACAAGCTGGCATAGCTGATCTTATTAATCTTG
TAGACCGTTCAGGATGACTGGGCTATATTATGGCGTTAACTTTCGCGTTGGATTACCTTT
TTATGCGATGACAAGATGCCGATAATAGGTATTTACTTTCACAAGTACGTGTACGCAATT
CTAAAGGAAGTATATCAAATAAAAGGGCGTGGTACATAAAAGCTATATCCCTAGCATGAC
CAGTCTAATAGATTTGGGCAGATATGTTGAAAGAACGCATCATGGAGAAGATACAGAGCC
AAGATCGAAAAGGGTAAAAATCGCAAAACCTGACTTGTCTTCCTTCCAACCAGGCAGCAT
TATTAAGATCCGTTTACAGGATTTTGTTACTTACACTTTAACCGAATTCAATCTTTCACC
GTCTTTAAATATGATCATTGGGCCAAACGGATCTGGAAAATCTACTTTCGTATGCGCAGT
GTGTTTAGGATTGGCTGGTAAACCCGAGTATATTGGTAGGAGTAAAAAAGTGGAAGATTT
CATCAAAAATGGTCAAGATGTTTCAAAAATTGAAATCACCTTGAAAAATTCACCAAATGT
TACTGATATTGAATACATAGACGCACGTGATGAAACAATAAAGATTACCAGGATTATTAC
GAGATCCAAGAGGAGATCGGATTATCTAATAAATGACTACCAGGTATCTGAGAGTGTAGT
TAAAACTTTAGTTGCTCAGCTGAACATTCAGTTGGATAATCTTTGTCAATTTTTATCTCA
AGAGCGTGTTGAGGAGTTTGCTCGCTTGAAGTCAGTTAAATTATTAGTAGAGACTATAAG
GTCAATCGATGCAAGCTTATTGGATGTGTTGGATGAACTAAGGGAATTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved