Saccharomyces_cerevisiae Locus Mono:28:snR30
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:28:snR30
Saccharomyces_cerevisiae
Mono:28:snR30
XII
snR30
1001..1606
2606
ATTACTCTGTCTTCCTGAAAGGCATCGGATTGCGTACCGAAGATGATCTTGGCGGCGTT
AGATGTCAAACTTGGCAGACCGGTAATACCGAGGTATTCATGGTTGTAGGAGCTGTCGTT
ATGAATTAGCTTTTCGGCGGCTTTAACACTTGGCAAGACCCATGGTTTACCGTTGTCGTC
TCTGTAGGCCCCGATACCCAAGTCGACCTTGGTAGCACGTTGATCTTGCCCGTACCTTTG
CTTAATACCAAAAAGGGCATCAGGGGGCAGCAATTCGATGTTATTGAACAGAGTGGCAGA
CATTATCGCTCTTGTGTTCTTGTATTCCTGTGTTCTTTTGTTCATTAGAATTTGGACGGT
TGCGCTTTCCCTTCTTAAAGTATCCACATACGTTTATATACCGACGTGCAAGGCGACAAG
GTAAATGAGGCCGATCACGCTGACTCACTCGGTCCGACTCTCGGCGATCGTTATTCACGA
AGACGAAAGATAGCCATTTCCAGTGGTGACCATTAGTATTGACAATATGTACATCGCATT
AAACAGTAAGAAAACATTAATATTCCGTCAGGAATTCCTGTAAATTGCTCTTACTACAAA
CCTGCAATGCCCATATCATCATATTCAAAGTAAAAATTTCATTTTCCGTAATTATTCTTA
TCTTTGGGTGCTTTGTGGCAGCTACTGGAGTAATTGTGTATAATAGATGCCACTAGTGCA
GTTAAATGAAATATCCTACATTGAGAGTTTAAAAAATTGCCTCCTTGTATGTTTCTTGTA
AATAATGATTTTATGTCCTTCTAGCGTAGTAACCCTAAACCATCAGCGGCTATTATTAAC
ATTGTTACCCTGACAGTGCTTTTTTATTTCAAGAAAAATTTTCCTTTAGATTCTCTCGCC
TATATAAACACTTTGAAACTCTCATCGTCGTGCATTTAACTTCTATGGTAAACTTCTTTT
CCCATTCAAGTTTCTCTTTGCTTATTTGTAAAAAAAAAAGTAACCATAGTCTCGTGCTAG
TTCGGTACTATACAGGGAAGGGAAGTCACTCGCATACGTGTGTGTGCATTTCTTGCTATT
GCTGCTTAGCTTCTCTAAAACACTGGGCTAGCGTTTTTCAACGCTCGAGAGGCAGAGTCT
CAAGGAGCCTCCAATGGGCCTCACGTATTCATCTAGATGGCGCTTCGGACAACGGCATCA
CATAAGAGATGCAGCTCCTGACTTCTCCTCTGATCTTCGTGATCAGAGTTTTGAGTCGTC
AGACTACGAGCAGTTTCTCTTAGTCGTTGCATCGGGTGCTGTTGCCTTAACGATGTGTAT
ATGGGGTTCGGGGGCTGTTGCCATGATATATATGGATGAGACAGAAGTGGCCCCGTTGAC
GAGTTTAACTTAGATTAAGTAGGACGCATGATCTTGAGCTCTTTTCCTATACTTTGTCCT
ATGGCCAGCTTTCTCCTTATTACGAAGAGATTGCGGGATGTGGGTGCAGAGTGGGAAAAT
CTGAGTTCGGTCATCTTTGTTGTTCGTCCTACCGCAGTATATTCCTAAACACTATGAAAT
GACCCTAGTTGGTCCATGATCATTTGGGTAAAACCATACTGCAGACATCTCTATAATTCA
CATATTCACATCTTGTCCTCTCGCAGAAGAGGAAGGCCTTTGACGTAGAAAATTAAGTAA
ATCGTATACGTTTACGTATATACACTTGTATTCAGCTATATATGTTGTTTCTGTTCTTCT
CATAAAATGTACCCTACTTAGTGGTGGAATAAACGAATTGGGTTCTCCACGTAGACGATA
TCAAATGAATCCGCCGCTTGGAAGACAACTTTGTCCATGACAGACCCCGAAGGAGCCGTG
ATGAACTTTACACCAGACTGCACAGCTCTATAAACGTTGTCTGGGAAGGGAAAGAACGCA
TCGGATGATAACGATACATTGTTTAATTTGCTTAACCATTCTAGTCTTTCTTCTTTGGTG
AAAGGTTCAGGGACTTCTTCAAATTTGCTTTCGTAATCCACCTTTTCCGGGCCTTCTATT
CTTTGCCCTGTAACAAAAAGATCAATCGCATTCGACTTGTCCGCTCTCTTAATTCCCTTG
GCCCACTTCATGTTCAAAACCTTTGGATGTTGTCTCAACCACCAGTTGTCCGTCTTGTCA
CCAGCTAATCTGGTACAGTGTATACGCGATTGTTGGCCGGCCCCAAGCCCCACAACCATA
CCATTCTTTGCGTAGCAAACAGAATTTGATTGTGTGTATTTTAAAACCAGCGTAGCAACA
GTTAGATCGATAACGGCTTGCTCGGTAAGTGCTTTGTTTTTGGAGACAATTTCTTTGAAA
GTGGATTGGTTTATGATCGCATCGTTTCTCTTTTGTTGTAACGTTACGCCAAAAACCTCT
CGGGATTCCATTTGGCCAGGAACATAGTTTGGATCGATTTGTAAAATACAGTATTTTCCG
TTTTTCTTCTTAGATAGTATATTCAATGCCTCTGGTTCATACCCTGGAGCAATAACACCA
TCGGAAACTTCTTTAGAGATGATTTTTGCAGTGGCGACATCTACAATATTGGACAATGCA
ATGAAATCACCAAAGGATGACATCCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved