Saccharomyces_cerevisiae Locus Mono:3:snR33
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:3:snR33
Saccharomyces_cerevisiae
Mono:3:snR33
III
snR33
1001..1183
2183
ATCTCTTTTCGTTCCTTTTTCTCGCTCGAAAATTTTCAATAATTTGCAGTAAAAAGGCG
ATGCCAGTAAAAAACTACCTGCAAAGGGAGCGTTAGACATATCTTTTATTGGCGACAAAT
ATTTTTAGCGATATATATCCGTAAAGATCTGGCGATATTCTTTATCACTCGATGATAATA
AATTCTTTTACACTTTGCTATTTTCCATGAGAACGGTTGGTATTCCTGTTCCCAATAACA
AAAGCGTTTGCATATTTTTATGGTGAAGGTACTATCAACTGTAAAGTATGTACAATAGAT
TTATTAAAGGGAAACACTTTTCGTAGTAAGAAAAGCAGGTTTATAATTCAATTGTTTTAA
AGCTGAATAATGCCGTGGTGTTAAACTACGACCGAGCTATAGCAACAGCATCGGCCACAC
ACTCTCTCTTATTCTTATGTTAATAGTCGACCTTTCAAGGATGTTCTTGTTGGAATAGAA
ATCCACTATCGTCTATCAACTAATAGTTATATTATCAATATATTATCATATACGGTGTTA
AGATGATGACATAAGTTATGAGAAGCTGTCATCGAAGTTAGAGGAAGCTGAAGTGCAAGG
ATTGATAATGTAATAGGATAATGAAACATATAAAATAGAAGAAGGGATAATCGTAATATT
AGTATGTAGAAATATGGATTCCATTTTGAGGATTCCTCTATCCTTGAAGAGAACTCCTAG
TATATTCCGTATACATAATATTGTTGCTTTTCTCGAATCATGTATCAAGATTACTAGCGC
AAGTGGTTTAGTGGTAAAATCCAACGTTGCCATCGTTGGGCCCCCGGTTCGATTCCGGGC
TTGCGCATCTTTTTTACTTTATATACTATTTTTTTTTTTTTTCTTTTTCCCAAATTTTTT
CATGAAAAATTTGGCGGAACGGTACATAAGAATAGAAGAGATTCGTTATGAAAATTTTCT
ACTCTCTTTCACATTTTTTTTTTCATAAGAATTAAAAAAATAAGCTTAATGCCCTCTTTG
TACGATGGTGTCACTCTAAAATTATTTACGTAATTTAATTGGATGTGATATCAAGCACTA
GTTTTGTTTGGAGGAGCAGAGATTGAAAGCCTAGCTTTTACACCGGTTTGAGTCGGTTCC
TTCGTTTTCTTAGTTGGAATTGATATAGAAGTGTGTGGACAATCGATTTGCAAAACTTTT
TATTTTATGTATTACTACTGAGCTTGTTTATCTGTATACTTTTTTCTTATTATTATGTAG
TTAGAGGTTAGTTCTTATCGTTTTCTTTAAAAGCGACCTTTCTTCGCACAAAGCAATGTT
GACAATCGAGCCAATGCATTTAACAATTGCAGTAACCAGAAGCGAACAGTGGAGGATATG
AAAACCATTATTATTTCAGATTTTGATGAAACAATCACAAGAGTTGACACAATCTGCACC
ATTGCTAAATTACCGTATCTACTGAACCCGCGGTTGAAACCTGAGTGGGGTCATTTTACC
AAGACATATATGGACGGATACCATAAATACAAATACAATGGAACGAGATCACTGCCGTTG
TTATCTTCAGGCGTACCTACGATAATTTCGCAGTCTAACTTCAATAAGTTGTTTGCGGAC
GAATTAAAATATCAAAATCATAACAGGGTTGTTGAGTTAAATAGTGTAAATGAAATTACA
AAACAACAGATTTTTAAGTCGATTTCTTTGGATCAAATGAAAACGTTCGCCAGAGATCAG
AATCACGAAGATTGTTTACTAAGAGATGGTTTCAAAACGTTTTGCTCTTCAGTTGTCAAA
AATTTTGAAAGTGATTTTTACGTTTTATCTATAAATTGGTCAAAAGAGTTTATTCATGAA
GTCATTGGTGACAGAAGACTTAAAAATAGTCATATTTTTTGTAACGATCTAAAAAAAGTT
AGTGACAAGTGTTCTCAAAGCTACAATGGTGAATTTGATTGTCGGTTATTGACAGGCTCT
GATAAGGTCAAGATACTGGGTGAAATATTAGATAAGATCGACTCAGGTTGCAATAAAGAA
GGAAATTCTTGCAGCTATTGGTATATAGGGGATAGTGAGACTGACTTGTTGTCCATATTA
CATCCATCTACTAATGGTGTACTGCTAATAAACCCGCAAGAAAATCCTTCCAAATTCATA
AAAATTACCGAAAAGATTATTGGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved