Saccharomyces_cerevisiae Locus Mono:42:snR8
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:42:snR8
Saccharomyces_cerevisiae
Mono:42:snR8
XV
snR8
1001..1190
2190
ACTTAATGCAGTTTCACCAACTGCCATGAAGGCAGCCTTCTTGGACTTTCCGACTTCGT
CACCGTTAGAGTCAAACACAGAAATACCCTTTCTAATTTCGTTGCCTCTCATTAGGAAGA
CGTTGACAATACCGGCACTGACCACGGCGGCAAATGGCACCAAACGGCCCAAGATCAACT
TTGAATGTGGAGAAATGTTTTTCAACCTGGGAACTAGGTTATTTAGACCTAACGCAACAC
CACACGACGCAGTTACAGCGGCAGCGTAATTGGTGAGCAATTGGGACGTGGACATAGGAT
GAGATTTGTTTGCGTTAGCGGAATTAACGGCGACGTTTAGCGATTGATTTGCCCATTGCC
AAAATACAGTCCCTGCCGTACCCAAACCAGGCGTCAGCATACCTACAGTAACGACTAGGT
TTGATAGCACGTTGGAAGACATACGGAAGGGCAAAAGAACTGTCTTCCCTGTGTCCGGAT
GCACGGTGGAGTCCAGTTGTTTCTTGGCTCGCCAGAACTCCGGAGTAGTCTCTTTTAGTT
CACCGTGACGATACGCACTGATGATTTCTCTAGCATGCGCCAGGTCCTTCTCAGTAGTTA
ACAACATAGTGGGGTCGGAAATCTCTGCGCAATGGCGGATTCTACCCCAATACGTGGATA
AGTCATAGCGGGATTCGGGCAAATCGATGGGCCCTGGGACTGATGATGCCATATTTCTCT
GCCTTGTTTATTTTTTTCTTTCGATGCTGTGTGGTTTTATTATTGCTAACTTGCAGTGGT
CGACGCCTTTGAAAACTGTAAAGCTGATGCGAAGACCTAACAGTCTCTTATCCAATTACC
TCAATCTGGTACGCTCCGGTACCGGACGCCAGTACGAAAGAAAAACTTTTCGTTCGTCTC
GGGCACCATTGGTATAAAAAGCGCCGAGGCAGCGATCATTTTTCTAGTATTACTCTTCTT
TCATTTTTTAGTTATCTTTGATTTTCGGTTCCGAAGAAGGCATGATACATATTAAACATG
CCTTCTATTCACTGTGCCATCTTACATCCGTAGGTGATCAGAGGGGAAAAGAAGAGCTAG
AGCAACTCCCACACTCATGAGCGTCCTCATACTGTTCTGGGCGCTTCTCACAGGTGCTTC
TTTTAGTGTCTCCCATTGGCCCAGATCGGTAGCTGCGCGAGTGAGATATCTTTCATTCAT
TTATATTTATCTGTAGCAATAGCTTCCTTTACTATTTTATTCTTAGGGAGAACTTTAGCT
TATTTCTTGCACAAGAGGGTTTGACAGTTTTCTGTTACCCGGCCAGTACTTCAAAAATTT
TTCAAAAATTTTCTGAAGTGCTCATCTCATCGCAAACCGTAGGAGCAGTGAAAGGCATAT
GCTCATCTGTATAATTGCAAAAAGACATATTCTATGTTCGCAGAACCAATACGTTACCTA
AAGTTTTAAAGACAATACCAAGGGAAACTGCACAAATTCAATATGACAGAAGATAAATCG
CAGGTTAAAATCAGGTTTTTCACGCGTGAGAAAGATGAATTACTACATGTACAAGATACT
CCAATGTACGCCCCCATCTCATTAAAGAGATATGGGTTGTCCGAAATTGTCAATCACTTG
TTGGGCTCGGAAAAGCCTGTTCCTTTCGATTTCTTGATTGAAGGTGAATTGTTACGTACT
TCATTGCACGACTATTTGACCAAGAAAGGTTTATCGAGCGAAGCCTCGCTGAATGTAGAA
TATACCAGGGCAATTCTTCCACCATCCTATTTGAATAGTTTCAGCAATGAGGACTGGGTT
AGCTCATTGGATGTCGGCGACGGTTCCAAGCATATTATTAGTGGTTCTTACGATGGTATA
GTTCGCACCTGGGATTTATCAGGTAATGTGCAAAAGCAGTACAGTGGTCATTCTGGCCCA
ATCCGTGCAGTAAAATACATTTCCAATACAAGGCTAGTTTCGGCTGGTAACGACCGTACT
TTGAGATTATGGAAAACCAAAAACGATGATTTGAAATTAACTTCACAACAACAGGCACAG
GAAGACGATGATGACGAAGTAAACATAGAGGACGGTAAGACACTGGCTATCTTGGAAGGT
CATAAGGCACCAGTAGTCTCTATTGATGTTTCAGACAACTCAAGAATATTATCTGCATCA
TACGACAATTCTATTGGGTTCTGGTCTACTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved