Saccharomyces_cerevisiae Locus Mono:30:snR34
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:30:snR34
Saccharomyces_cerevisiae
Mono:30:snR34
XII
snR34
1001..1203
2203
ATTTAAAGGTTATGAGGTACAGGAAGGCTGAAAAATGAAAACTTCGAGATGAAATAATC
CACGTCGAAAGTAATGCTGAAAACACAAGTAGCTCTGGATTCAAATCATAAGGACGTACA
GAAGTGTTGCTGACAAATCGCTTCTTTTTGATATTAGAATTTCATTCAATGAACAACGGA
TTGAAGAATTGTCGTGTCGACAGGATTGTACATTTTACCAGGACTGAGGAATGAATTCAA
CGGCTTTGCCGAACAAATCACGGCATAACCTGCAGAATAACATAACAACATAGCGCTTAT
TATCATTGCGTATGCTGGCTGAAACGAACCTTTCACTGAATCAGCTCATATCGCATGGAC
GGAATAACAGGTATAAAAAATCCACGAGTTATCAACCTCATTCTCTTTAAAATTGGAATC
CAATCAACCGAATTCATTTGTACTAACAACGTTTCCTATTATTGCAGATAAAATGGCTCA
CGAAAACGTCTGGTTCTCTCACCCAAGAAGATACGGTAAAGGCTCCCGTCAATGTCGTGT
TTGTTCTTCCCACACCGGTTTGATCAGAAAGTACGGCTTAAACATCTGTCGTCAATGTTT
CAGAGAAAAAGCTAACGACATTGGTTTCAACAAATTCAGATAAGCCATCATAAATAAACA
ATGACGAATATATAAATACTATATGTATACATATATCAAACTGCCTTTGTACTTTTTATG
GTCCTATTGCTCCCCGAATCTTTAGATCCTATATGTGCTCTTGAGTATCGTTGGAGGATT
CGTCAACTCGAGGTACGAGATATGCTTTGTCTCTTCCTTGTATTCGCTTGCTGATATTCC
GTACCCTAGATTTCTTACTTTCGAAATACATTACCCGGATCAATTCCATTATTTTCGCCT
TTCAAAAAATTTCCCGGTTGTATAAAAAGGCAGGACTTCGACAGTCAACAACAATTTTGA
GTATATTTACCACATTTTTTCTGATTTTTTTTTAAGAGGGTGAATCAAAAATTTATTTTT
TACACGGAAACGATGCCACAGTTGACTGAACCTGTCTTCTAACAGTAGTTAATTGCCAGT
ATTTCAAACAAGATTTGAAATACGAGTTTCCCAGAATAATTTATTTGGACAGGATAGGAA
GTCCGATTTCTGTGTTGTCTCAAACGAGGCGATAGAATTGGGATGTCGAAGAAAGTCTAC
ATTACTCATATATTTACGTACTGTCTCTTGCAGGTAAAAAGTCTTGAAGATCAGTTTCAA
TATTGAAACTAACAAATTTAGTTAGTTTCTGTACTTAGTCCGAGGTATGTATGCTAAGAT
TAGAGGATGGTAAAAAAATCAGCTATGAAAATACATGTACGTACGTTGTCGTGCAACACA
ACCCCTTCACTTTCTATTTCACTCTGATTCAGAACTATTATTCAGCTTAGGAGGCGCGGA
AATCTCGAAGTCTTTCATTGGTTGACGAACGGGAGCTACAAACAGCGTCGACTTGAATGC
CCCGACATCTTCGATCAACTGGCCAGTTGGATACTTAGCGGTGTCCAATTCATTTTCATT
GAGCTCTTTGTTTTCCACTTGAGATTTCAAATGTAGAATCAACTTCGATGCGTTCTCGCT
CATTATATAATTCTCATAAAAATCTATCATTTGCTGCTTTGTAATGTTAGCAACGAGCTT
AGCCTTTTTTTGACGATGTGTGAAATTGTAATCACCTAAGTAAATTGCTGCTGTGTATCT
GGCGCTTTCCTCGGCCATATTCTTGAATTTTTGCAATAGACTGTTGCATAACGCCTCTTT
GTGTTTTTCAAAGTCCTCTTCTGGCATATCCCTCAAAACCTGGCCAAAAGTTTCATAAAA
ATTGTTTATTCTCCATTCTAGATATGGCGTGGTATGTTCTGACTGAATCAAGATCCTAAT
GTTCGCTGTACCGTGATTGTTCAAACTCGAACTAAAAACAACGTAGCCCAATTGCTCTTT
TGTTCTTAAGGTATCAAAACATGGCTCGTGAATCAATTGCGCAAATAATCCGCTGAGGGC
AGATAGGTCTTCTGAATAGACATCTAGCTGGGTGACATGTTGAATACATGAGTTAACATT
CTGGGAGTCTTTCAAAGCAGTTTCATATCTGAAAGTTTTGCCTTTAGGAAGTAAGTAGGA
TCTCAACCGGTTGTTAGAAACCTGCAGATTATGAATGTTGTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved