Saccharomyces_cerevisiae Locus Mono:23:snR3
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:23:snR3
Saccharomyces_cerevisiae
Mono:23:snR3
X
snR3
1001..1194
2194
GCCCTATCTATTCTAGTATCGCCAATGTCTTTTAGCTTCTTCGCCCTAAAGTTTCTTTT
TGGTGCAAGAGTCTTCGAGAAAAACGTGTGTTGAGAGAGGCAATGTTTAACGAAGAAAAA
AAACTCTATGGAAATCCAAGAAGTCCTTGTTTCTTTGTTTTCGTTTCTAATATATGCAGG
GTCAAGCGGGAAAAAGAAAGACAGACGGAAAAGTGCCCAGCAACACGGAACAAAATTGTC
CAGATTTATTCGAGCGGCCGCGGTTAGTATGCATAATGCAGGCGCCCCTCGTCCAAATGC
GAACGGTTCCATCCGAAACAGGCCATTTCCCAAAAATTATTTCTCTTAATAGAAGTTGCT
CGCGTAGTTACCTATTGTCGATGCCGCATACGCAGTTACCTTATCCGTTGCCCTACGGAG
AATTTCCGCGATGCAGCACCGTGCGGCGAGATCACAATTTTCCTTGTACACTCTACTCTG
CCCCTGGAGTGGTTCACCCCCGTCTGTGCGTATTTTCGTGTATGATGATATAAGGTCGTT
ACTACCGTTGATTCAAAAACAGTTGCTTCTTCCATATATTGTAGCACGAACAACTATGGC
CGGCCGCAAATTGCGACAATTACACCTAACGCAGCATTAAGGTCGCAGGAAATGTTATCT
GCCGAGCTGTTTATCTCTGTTTTCCAAGATTTTTTCAACCAGCCCATGAGTCTGCTGTTG
GCGGCAACCCAGTTACAGATAATGGTGCATGTGATAAGCTTCGTACCACTATTCGTAGTT
TGTTACATCTTGTAAGCCAGTATATATATTTGTTAGATTGTGCCCTAACGTTCCAGTAAT
TGAAGGGTAACCGAGGTTTCCGTGGAAAAAAACCGTGTATAAGCAAGAGGTTCCGAGCGA
AAAAAAAAAGTATAAAAGAAAGCACAGGCAATGAGATTTGTTTTTCGCTTTTCCTTCTTA
TTTGTTAATTCTATTTTTGAAGTTTCCTTCCGAAAAAAAGTAACTTTGTCCTAAAGTACT
AATCCACCGCATTAGACAGTACGAAGATCGAGCTATTTATTTGAACACTCGGTCTTATTC
GTGATAAGCGTAATGTGGAGAGATCAATTTCCGGGTCATTTATAAGAACTCGAGTGGATT
GCTAGTTGTTTTGATTAGCTGAATGAGACTCGAGTGTCAGAAGATGACTATATTTTTTTT
CTTTTTTTTTTTAGTTATGTTTTATTTTTGAACTTGTACTTGCACATGTATCTTATTGTT
TCGTGATCTTGTAGATCCGTATGGGTGCAATCAAAGGTTTGAATTGCAGGGCTTTCATCG
CGCGGATCTCGTTGTTTGCGTCGTACTCTGTGCTGGTGACTATGGTACATTTTAGCCCGA
GTTTATTGCACTCTTGAGAAAACAGTTGGACAGTGGATTCGCTTCTAATTGTCGCGGATA
GGAGACACAGTTTGCATCGGTCTAAAGCAAGACATTCGGCCAGACACTCGCATAGATCAG
GAAGGATAGTTGGGTCATACGTAACATCTGCCCCCACTACTAAATCTATATCCTCAGGAA
CTCTATCGCTGCCCCACCATAATCTTTGCAACTTGATGTCTGGTTCGTTCTCACGCACTT
CATTGTTCAATTCAAAATTTCTTTTCAGCTGCGTCTCAACGAGATTCGAATCACCATCCG
TGACGTACATCTTATTTACGAACTCGTGATACTTTTGTAAAATGACGAGACTCACTATGC
CTGTGCCAGCGCCGACCTCAAGAACATTTAATTTTTTCTTGCCATCGTCTTGTCCTTGTA
CCGGTGCCAACTCTTGTAAGGGCTTATGAATAAGGAAATCACCCATGTATAAGGCAGCTT
CCCATGTCCTGAAACCTGTAGTACTGGCCGCACTGATCAAATTCGGTGTTTCCTCAATTG
TGATCTTTACGTCCTCGTCAAACCTGTACCTCACGACGTCTTTCATCATCGGGTCTGGCT
TGCCTGTGCTTAATAGTTTTATGTACTTCTCATAGAGATAATCATATATCTCTATCTCGT
CTTCGCCATCGTTGACAATTGTGAATGCCTTCGCGAAAATCCATTCGTGGTCTAAGAGCA
TCTTGACTATGGTTTTGCAATAATATGCATTCGTCTTTTGCACAAGTTCCATCTCACAAA
CAAATCTCGATGCATGCAGGACATCGTTAGATTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved