Saccharomyces_cerevisiae Locus Mono:7:snR47
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:7:snR47
Saccharomyces_cerevisiae
Mono:7:snR47
IV
snR47
1001..1099
2099
GAACACATTTGAAAAAGGGACAATAATTGACGGTATACCCGTGTTTTTCTCATTAGCAG
TACTACTATTCCGCACTTTACATCATTTTTTATAAACTCATGCATACATACATTGTACTT
CAAAAGATTTTTTTTTTTTTTTGGCATCATAAATCACTTTCAGATCAGTTTCCTTTCAAA
CGCGCGGCATTAAGAAAACTTTTAATGTCAAAAAAACGGAAGCAAAAACCCCTCCCTTCC
GCTTAAGATCATGTCTGGACATTTTAGTTGTAAGGCTGCGCCTCGGTAGCAAGTAGTGCT
GCAACAAGGCTATTATGCCACCTAAACAGACCACTTTTGCTTAATACGAGACTGTGACTA
CCTCCTGACTTCCTGTCATAACAAAAAAACAGACGTCGCTGCATTAACATTTACAACCCC
AAACCTTCTTCATTCATTGCTTTTCTTTTAGAAACTGTGGCTTTTTGACATTTGCAGTTT
GCATAGTTACTTTTTGATCACTAACAACGATATATTATCGTTGAACAATTTACTACGCAA
AACAGTTCACGTGATGTACGTCAGATAATTCACTGAAGGTACTACCTTTCGAGCATCTCT
TACAGCAATGGTAACAGCTCATTGAAGAAGAAAAAAATAAGACAAATTTTTTTAGAGCTG
CAAGCGTTTTTACTAGGCATCAGAACTGTCTCCGAACAATAGTATAGTTAATTATTATAC
TTCAACCCTAGAAGAAATACCCGAAGATGTAAGGATGTTTTTGTTCCTATAAGCTTTTTT
TTTTCACAAAATTTTCATCCACTCTACGTCTTCCATACGGTCATATAAAAGGTGCCATAT
CCTCGGCCAAGACAAAAGGCTTCAGCTCCATATCTTTTGAAATCATGTAAACGCATGGGG
CTCAAGTACTGAGCAAAGTAGGAGAAAGGATATTGAACATGTTCAGAAGAACGTGGTATC
TTTTTCCTTATTATACATTCTCTTGGCGAGTGATCGAAAATATATATGATGATATCCTAT
AACAACAACAACATGAATTTCTTCGTCCGAATCCTTTATAGGTGGAAACAAACTTTGACA
ATAGCTTTTTAACACTGATAATATATTTTCGCGTCATTCTTGCTGATTTTCTTTTTTCTT
ATTCTTATTGTGCTTCATCCTCCATCTTCAATGGCGGTAACGTAAATCAGAGTAGCTTTC
ATTTTCTTTATTTCTGTTTCTGTTTCGCGTCGGGATAACAAAGCGTACTTACTAATGGCT
ATTATTTTTGCTAATGACACAAAATCCTGTTACCAATTTCCAAGAAGAAAGGCGGATAAC
AGGGAAAAATTTGAATCTGTGTATCTGCAGTACAAATATTATATATTGGAAGAACACGCA
CTTATATCTTCTTCATGTTTGTCATTTTATTAGAAACTTTACTATTGAAAATAGCGAATC
AACAACAGCTAACAAACGACTAGGTCTCTAAGAGAAAAAATCTTTTTCTTTTCACAACAT
GGAGCAAATATTATATAATCAAAGCCTTAAAATTTCTACCCTTTCTACTTTTCAAGGTTT
AAAGTTTCTAAAGGTCCTCATTTTTTCTATTTTCCAACAACTATTTTATAACCCAGTTAT
ACAATTATTCGGAACGAAAGCCTCAATAATGGAATCTGATTCCACTACTCTGCTCGAAAG
TAGTTGGAGTACTGAGCGAAACTTTCTCAATATGAATTCAGATTCCATATCTGCTACCAA
GAATGTTTTTATATTATTTTTTACCATTTTCAGATTAGCGGAGTATATTGTATACAAACT
CTCTGACCAGAAGTATCGGTTACACACATCCCTGAATGTCCAACATTTCAGGTGGAATTC
GAAGAAGAATACAAACAGAAAAAGGACACTTTCCTTTAGCAAAGCTTACTTACCAAGAAC
AAATATACTACCGATTTTTGTAGCCGATGGACTAAAAAATAGATTCTCAGGCCCGCTACC
TGGTAAGTCCTTGGAAAGCTTCCAGAAACTAAATTTATTGAGCGATAACAATATTAAGCG
GTATGCAGTACCAGGAAACAAAGCAGTGAACACACTTTTATGGCAAGAGCAATACTCATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved