Saccharomyces_cerevisiae Locus Mono:32:snR83
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:32:snR83
Saccharomyces_cerevisiae
Mono:32:snR83
XIII
snR83
1001..1306
2306
GTTATAAACGATTGAAGGGATCCGCTGAGGAATGAAAAAAAAAAATAAGAAAGTAAGAG
AAGGGAAAAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAGGGAATGATCG
AAGATAAAAATTCTCAGAAATTTGAGAAGAAGGAAAAACTCTACTTAAATAAAGATAAAC
TTTTCATGGCTTGAGAGTCCGGCATCCACGTAACTTAATGGTCCGTGCGGTAACATGGCA
GGGTGTGCAGGACCCTATGGCTCGAGAAGTTGCTACCGGTGTTTAATTTTTTTTTTATCT
TAATATTAGGAAGAGAAAAAGCATCAGTTACGAGACTCCTGAAGGAGCGCCGGAAAGTTT
CTTTTTTTTTTTTTTTTTTTTAATTTTTTTTGTGTGGGGAAAGACCGACTACCAGTAATA
CTTTAAAGATATTATTAAAAGAAATCCCGAAAAAAGAAAGACCATGAGAAAACCGAGTGC
GTTTCATGCATGTAACATAATATTTCTTCCCCTCGTTAAGTGTGCATCAGCAACCATAAT
GCTGAATTAACCGCAAAGGTTACCATAAAGGATCGCATATAAACAAAACTCGCCCTTTCT
CCTGCATCCCTTACCGAAAAGGAAAGTTTATATACACTTAAAGGAAAGTGCTACTGTAGG
TCGTCAGGCCGTTGATGTACTGCTCTTCGAGACAACTATTGTACCTTAACTGTAAGAATT
TGCTCAAGCCCTCAAAAAACACAACGTGCGGGTAACGACAACGAAGTGGGCGCAAGACAA
AGATGGAATATCCTATCCGATGGGCACTATAAAAGGCGAAGGGAAAATTAGTTTTTTTTC
TTGTCAAGCATTTGCCGAGCGCTTCAATGTTGATTGGTCTAGAAGTAACAATCAAGACAG
ATAAAGTCTAGTACGTGTGCAGGTTAATGCGCAAGTGAGAAGTGTAGATATTGTAGTTGT
GATATTTACTATTCTAACTTGGCGCTATTAACGCTTTCACAACCCAAAAACATCAAGAAA
AGCCTTTCAATAAATTGCTCTTCTCTTGGCGAAAGAAAGCGGGGGGCAAAAAGAATCACG
GGACTTATGTTTCGGGATCTCTTTGTTTCTTCTTTTTTTCCCGGAGAATAATTTTTTAGG
ACCAATTACCGTAGTTGCGACTACAACAATTGTTGTTCATACCCCCACGATTTACTTTTT
GAAAACTAGTTTTTGGAATAATAATGTTGTAAAATTTCCCTTTTTCCACCCCGATTTGTA
TTTTATTTTTCGTTACAAAATTGGGACTAATATTAAGGGCGACAGTTTTTCTTAAAAGTA
AGATTTTTTACTTAAAAATTCTTGTTCTTAACGAAATTACATACGTATTAAAATTATTTA
TTAGATAGTCGGTATTGTCTTTTTGTGAAAAAAAAAAATTATAATACTAATTGTTAAAAA
GGCAGGTATGAGGAGGGTATAGTAGGAAAGAGAAAAGACGTTACAATTTTTAGGTTTTCG
GTTTTAATAGAAATTGTTTGATTACACATAATAGGAATTGGGGGGCTGGCGGGAGGGAGG
CGCATGTGCTCTATTACTTTCTTGTTTCCACAACGGATGGAACAACCACAACGACAACAA
CAATAGCAAAGATAATAAAGCAGATGATCAAACATCTTATTTTGTTTTTTCTTGCTTTTC
TGGCACTCTTAACGGCCTTGTTGGTGTGACCCACACCTTGCTCTACATCTTGCTGAGCGT
CTTCGACGTTTTTGTCAATGACATCCACATTTTCTTGTTGTTCGATGACCAACTCTTCCA
TGTCATTGAACAATTGGGTAAGTTCAGCCATTGTTTTTTCCAACTTCAACAACTCTTGAT
GTCTAGCCTGTACTTCGGCCAATGCTGTCTTGGCCTCACCACGTCTATTGGCGTTTAGCA
ACGCTTGGGAAAAGATCTGCTGGCCATTGACATCGTTGATGGCGGCTTCCACTTCTTCGT
CAGTGGCTTCCGGTTGGATAATTGTGTACTGTCTCTTCGCCTGCTCTTTGCTTTCTTCTT
TGTAGTTAGAATCGATAATTCTGTAGTCTTGAATTAATTTTAAGAATTTCTGTCTGCAAT
TTTCAGCTTGTGCCTGTTTATTAGAGTCGTGCAATCCGTCTCTCTGGGCATCTTTGATAT
CCGCTTTCAATTGATACTGCAAATCTGTGGCCTGAGAGATGTAATCGTCCAAAGAACGTC
TCAATTCCATCTCCTGTTCCTCACTCACTTGAGTAAGTAGGTCTTTGTGTTGCGCATCAA
TTTGGTTGATAATGTTTTCGTACCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved