Saccharomyces_cerevisiae Locus Mono:43:snR31
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:43:snR31
Saccharomyces_cerevisiae
Mono:43:snR31
XV
snR31
1001..1225
2225
AGCGTCTTCTCCACCTTTAACATTAATGAAACCTGATCTTCTGATGAAGTTAGCAGTAG
CAGGGCCTACAGTATAAACTGTTTTACTGAGCAATGCAGCTTTTTGTTCACTTGTCAATG
TGGGAATGATCGCTTCATTCAATGACTCTACAGTCCTTTGAGAGGTAATAATAATGTAAT
TGATAGTATTCAAATAGTTTGGGATGGTATTCAAAACATTTCTAAAATCTTGAATTACAT
GTGTATGTTTAATAAGCGGTACGAATATGGGTTCAAACGCCTTACTCCTACACTCCAATT
CATATTTATCAATGGGGACAGTTTTATTCTTGAGCAGTAATACTCTGACTTTTTTACGAC
TAGACATCTCTCGAGCAAGGTCTATTTTACCTTTCTGTTTCCTTATCCTTTGACACTAAA
ATTCAAAAAACTCACTAGAAAGTTCACTAAAGCGCCTTAGCTGACTACAGCACAACCCAA
CCCCAAAAACTAGTGAACTACACACTAAGAGAATTTATGGTATTTCCATAATTGAAGTAT
ATGTACGATGTATACAATGTAAACAAGAGAGTAATGAAGTGAAGATATGTACACCTAGAG
CGAACCAATGATAATTTGTTTTCTTAATTAAGAAAAACCATTAAAACTGGATTAGATTTC
AATAATGAAAAGCTAGGAACAAAAAAAATTGGTCTACTTCCAGCCATTTGCGCTTTATAT
AGACATATGGAGGCGTGATGTCTTAAGCATGGTAATCCGGAAGATCAGTTTATTGAATGA
TGGTTTTCTTATCCTGAAGGATCCTGCAAATGAAGTAAGTTCAAAGAATTGAAATGAAAT
CGCCTTTTATACCCTCGCCGCACCAAGGAGCGCGCTGTGAAAATTTTTCGCTTTATCTCT
TAGGGCTCCTACTGTCGGTAGAGAAAAGTTGAGTATATTTAAAGCATGAGGTAACTTTTC
TGCCCATTTTTACTTCTATTTCCATTTGAATTCAGAAAAGTGAAGCAAAATTACACCATG
AGTTCCTATTAACGTCAGCCTCTTTTGTACTCATAATGTGGCTTCGGATGTTTGATGGGC
GTTGCTTCAGTGCGTACGGCTCATGGTAGATTAATTATTAGAAAGATGTATCTCCAGCTG
TTGATATTAGAGGGGGAAGCCTTTCTCTTTCACCTCGCCTTTTTAAACACCTGATACAGT
TGGTCATGATTCGTTCTACATTTTAATTTCTTTATGTAACCACGTTGTATATTTTCAATC
TGGAAAGTAACCTAAAAGAGTAAAAACTGTTTATTAAAAAAAATGTTATTCAAAATTTAT
ACATAGTACACGTACAGCTGCCTGAAGAAAGCATGAGCGAATGACTTATGCTTCGTCGTC
TTCGTCTTCACTTTCCAAAGCAGCAAATGCGTTGAAACCAAGAATTGGCTTGTCCGCAAC
AATATCTCTGGTATCAGCAGGTCTGTTGGAAGAAATATTTTTGTTATTTGGCTTGACTTT
TAAAGTTTCTTGGGCAATGGTAGCAACTGGCACAGTAGAAGTTGGTGTGGTTTCTGTTTC
TTCTTCATCATCTTCTCCACTACCCTTCTTCTTGGCTTCAAATGTGCACCAACCATCTGA
ATCGGTTGTAACCTTAGGCTTGTTGTGCTTAATCTTTGGTCTACCATGATGGTGGGAAGA
TCTTCTACGACCGAAATGACCAACATGATGACTGTTAAACTCTTCCTCTTTCAAGTGTTG
CAATTGCTTAACTTTTTCAATGATGGCTCTAAATTCCACCGCATCGAAATTAACTTCCAA
AGTTAAACTTGGCTTCAGTTGAAAAAGCTCATCGATAGTATACTTGATCATGTCGTGAAA
TTAAATAAAAGTTCTTAATCCTATATTCAGGTTACAGCTCAAATAATGTCTATCGCAATC
GGTAGAATATGCTTTACGCCAAATACTTTTTCCAATTTTTCACTATTTTTCGTCCAGGAA
AAGAGATATTCAAGCCTCGCTACTACCCGGCTTTATAATATAGCATAAGAAAAGGGACTA
TAAAGCCTTATTAAAACACTACTATACCCTTGCAGAGAGAGTATTATTATCTATGGAGAT
CCAGGCAGTGTGACATGAGTGAACTGCTTGCCATTCCACTTAAGCGAACTTTAGAAGTGG
ACTTTGCCACGGAGTTGTCAAAACTAATTGATACTACTTCCTTTCAAACGGCATCCTTTT
TCCAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved