Saccharomyces_cerevisiae Locus Mono:25:snR69
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:25:snR69
Saccharomyces_cerevisiae
Mono:25:snR69
XI
snR69
1001..1101
2101
GTCCTTTTTGAGTGTACTAGCTGGTAGTATAGTTTCGTCATTTATTTACGTTGGCATGA
ACACTATTGATATGATTGAGAAGAACTGGAGGTCAAGGTTCTTCGTTACTGATTTCTGGC
CTACGTTAGTGTATTTCATTGTTTTCGTTACCATCGCGTTCTTATGGAGACCAACAGATA
CTTCATACATGCTAGCCGCATCCCAACAACTACCCACAGACCCAGAAAATGTCGCGGACT
TTGACTTGGGCGATTTGCAATCGTTTGACGATCAAGATGACGCAAGTATCATCACTGGTG
AGCGTGGCATAGACGAGGATGACCTCAATTTGAATTTTACTGATGATGAAGAAGGACACG
ATAATGTAAATAACCATAGCCAAGGCCACGGGCCAGTGTCTCCCTCTCCAACAAAATAAC
GCTACCTCCAGCAGATTTGATTAGGTGATGAGACAAATAGTTTCTTCGAGGGCAGTCACG
AAATGTTTACAAGCGAAAAGAAAGAAATTATGAACCATATGCACTTCTGTTCAATGCGAT
GTGAATATGAATATGAATATAAATATGAATATAAATAAATAAATAAATAAATGCGTTGCA
CGTTTCTTTTCATTTATTTGTGCGTGCTTTTACCTGTTTATAACTGTAGTCACCAAAGCT
ATGCTATACTCTAGACCTAACTTTTTCGTTTTGTATTTATTTAGCCGCTCGCTGGAGTTT
TTTTTTTTTCGGTGATAAGATGATTTATATCAAACCGAAACAAGCGAAAAGTTTCTGTTC
ATCGACTATAAAATGGAAGAGAAAATTGGTCCATAGACTTTTCATGTGTACTTGTTTATG
AGAAGAGACGCAGGAAGACCAGAAGTGAGGAATTCCCTTTGTTCAAGGATGAACAACGAA
GCCAGATAACGTAAGGTTGCGCGCTGCATCAGTGCTAACCTTATTAGCTTTCTCTGGCTT
TTTCGGTCTTTCCTATGTAACATAACATGTATATTCTATTTGTTTATGATGAGACCACGT
CCTTAGTGACAATGCTATAAACCCAGCTCTTCGATTCGTTTTTAATGAAAGGGAGAAGAT
TTTTTTGTCAAACGCTCTGAGTAATAGAATATACATGCGACAACATTTGTAGTTACTTGT
CTTACGCTTCCTAGGGAACGGATCATCCGAGTAGAATATCATTTTACGGGATCACTTTAT
TCGGTGTGATTGCTCGTTAAGCCGCACGACCATTTTATGGGCACGCTTCCGCAAGTTGGT
TCTTTCATCAGAAGCTTTACCACGATTGGCAAGTCATGTAGCATGTGCGCTAACATCGTT
TATCGTTTTCTGTGACGTGGCTTATGAGCACCAGAGACGAATAATCAACAGTACATCAAA
CAAAAGCTACGTCACCTCACCAATAATCCGAGCTTCTTGAAATGGCAGGTATTGGATTCA
TAAAATATGTCGCTGCTTTGTGCATTTTCCTTTAGTTTTTTCCTTTTTTTTCATGTAGCT
AACTAAGCAAGACGATTATGGGAAGGGACCTTTTAAGGAAAAACAGGAAAAAAAAATAGT
AGCAACTAGTAAAAATTCAAAAAATAAAAAAAGTCAAAATAAGAACACATCAGTTAGGAA
CCGTGCTTGGAGTTTTGAGACTGGAGTATTGTCCATCCAACATATTCTGCTCTTTCACCA
TAGACTTCGTTGGAAATCGCCTCTCCCTTGTACTATATTGTGCAGAACCGTTCCCGCAAT
TTTCATTGGTGCAATAATAACACGCTTCTTCGATTCTCACATTTGTCAAGAAGCTGTACT
CTTCTCTCAAACTCCAATATATTTCAAATTATGAACGAGCTGAACACTGTTTCGACTAAC
TCCAGTGACTCCACCAAGAACGGTGGTACATCCAATAGTCCCGACGATATGGACTCCGCA
GCAGCAGCAAGTCACGCAATAAAGAAAAGAACAAAGGCCTCCCGGGCCTGCGATCAGTGT
CGTAAAAAGAAGATTAAATGTGACTACAAAGATGAAAAGGGGGTCTGCTCAAACTGCCAA
AGGAATGGAGACCGTTGTAGTTTTGATAGGGTTCCTTTGAAAAGGGGACCCTCGAAAGGC
TA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved