Saccharomyces_cerevisiae Locus Mono:21:snR37
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:21:snR37
Saccharomyces_cerevisiae
Mono:21:snR37
X
snR37
1001..1386
2386
ATTTGGAGAACATGGCAAAATTAGTAAGCTGCACACCGATGTGCATCTGGAGAAGATCA
GGCGAGATTTGTTTTGTCAGTAACGAATTCTATTCTTTAACAGGTTTTAACAAAAATTTA
CTATTAGACCGCACCTCCTTTATTTTTGAATATCTGGATCATAAAAGCGTTTCGAATTAC
TTTCAAATATTTAACGAATTGCTGGCATTTGGTTACAATGATATCAATAAAAGGAAAAAA
CTATTGATGTTGAACGCATGTTCTTCTACCTCGTCAAAAATTACAGAAGGGTTTTCTTTT
ACTACGGATGGAAAAGCAATCTTTACTAAGTGCAATTTATTATTAAGTAACGGTCTTTAT
TTGAAGTGTGCCTGTTGTTGGACAGTAAAAAGGGACTCGTTTAATATCCCAATTCTCGTA
ATGGGACAATTTTTACCAATTTTTGAAATGGACTGATCACTATTTTTTGGGCTTATTACT
GATTACAGTTTTTATATGCATTCTGTCCGTTTCTTTGATTTTATCGCTTATTTTTTACTT
AGGTTGGCAATTCAGTATTCTTTAGCGTTTCTTTTTTTTATTTTACTTTCCGTATCAACA
ATAATATTTATATTTATGTACAGTTTTACATTGTAATTTAGTTTCTCAGGAATTCGTCAA
AAATGTAAAATCATCCATTGAAAACCTTCTTCCCTGAAGAATTTTAAGCATAACTTTATA
TTTTTAAACAAGGTGGATCTAGAAACTTTGTATTAATTACAAGAATTTATAATATTATTC
GGGAGCAACAATATGGATTTCTTGCCAGTAAAACCCTACCTATTACTTCCCTCTTTATTA
TTAGCCGGGTCACACTAAATTGAAAAATTTGTTCTTTCCTGTTTTTGGAGCAACAGAAAA
GTATAAATAGAGCTAGTGTTGTCCGATTGGCAAAAACTTCTTCCCTTTGTTACTTCTTCT
TTAAAATTCAAATTTTTCTTTTGATTTTTTTTCAAAAGGCTAACATCAGTAGTGGTTAAT
ACTATCTTTAGATAATATTAATTTCATTATACCATAGAAACCTAAAGATTAGGTTATTTT
CGTTCTTCATGTTATGGAGTGTGAGTGATGAGGAGCTTGCTCTTTTAAGCTCATATTACG
TAATAAGTTAATACTGGAGCGAGAATAATTTAAATCATTTCATCATAACCCATAGCTGAA
TGAACTTTGACTACTCCTAAACAAAGTAGTAACAATTTTCATTTCGTTTCCGGTTTCTTA
GATCGAATATTATTCTGAGGAAATTCCCTGATTACATATCAGGGAAAGGTTCGCGTTTTT
AGAGAATTGCGTAATGCGATTTGAAAGTTTAAATTCCTAAGCGACTCTTCTTCATGATAA
GACAGTTTATATTTTGTATACTTTCTCATTCCCATAATTTGTAGTGCCTACGGGGATGGA
CTTGTCTTGGTACCAACTGACGGTACGTTCTGATGCTGCCTTGCTTGTGCTCCAACATTT
TTTTTTTAATTTCATTTTCGTGTACGGTGCGTATATCGAGATGGCATCTGAGTATATTTA
CTTTGGTACATATACTAATATTAACTAAATACAAGGATGGTGGTTGAAGATTCCTAACGT
ACAGGAAGCAACCAACTAGGAAAATATATGCACTGCTGCATGCTTTCGATAACACTTGTG
ACGTAATGATGGAGGCTTCCTTGACTACTGATTGCTGCTTGCACTATTATCTGCACCAGA
TGAATTTGTTGAATTCGGAGGAGGTTTCGCTGTTGAAGCGTCCCCTGCTTTCGCCTTCGC
ATTTTTTTCTCTCTGAGCCAGTTCCCATTTTAACCTTTCTGCTGCTCGATAAACTTTGCT
CTGTAAGTAGAAGCTTCCACCTTTTTCTTTATCGTTAACCTCAAATAGATAGTTAAACCT
GTTATTAATCTTGTCCATGTTTAAATCGCCCTTGGATTCTTCAATATTTAAAATTTTACA
ACTCTCATCCAACGTAATACCACCATATTCGCCTTTTCCTGTTCCCCTTCTAGATGCATT
TGTAGCACCTTGTTTCACTGATTGTGAAGCCGCTTGTCTATACGCCTCGGCGAATGCTTT
TCCAAAAACTTGAGTTCCTGTGATTATAACCTGTATGAAAGCCCTGTGAGCCATATTTTA
TATCCAACAAGTCTATGTTTTTCTTATGCTCAAGTCACGAAGCTGTTGCCAAATTTATAG
TCAGCTGAAATATGTGAATCGGATGCAAATGAGTTATAAGTTGAAGCTTCAAAATTTGCT
ACGTGAAAAATGATAAACGATGATGAAGTAAATAAATATCGTAAAACGAAAAACTCTCTT
TTAAAAAATTCATATGTAGGAATTTCATTTGATAAGAACCTCACTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved