Saccharomyces_cerevisiae Locus Poly:0:snR67
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Poly:0:snR67
Saccharomyces_cerevisiae
Poly:0:snR67
V
snR67, snR53
1001..1082, 1348..1438
2438
ACCGTTTGTGCACCACCTTCCCATCTGTTAAAGTCTATCAGCCTCGTTCTATTTCTATG
GCCACCACCTTGGTGACGGACAGTGATTTTTCCTGAATTATTTCTACCACCGTGCTTCTT
TCGAACAACAGTTAGGGCTCTAACCGGACGACCTTTGTACAAATATGGATAAATGGGGGA
ACGGTACCATCTCAAACCAGGTGAGACGGGTTTTAGCCTCTTCATCTGGGTCACTTCTTT
CGAAAGTTTACGACGTCTTTTAATCAATTCATCCTGCTTCTCAAGAGTCACGATATCAGT
ATCGTTAGGTATAATCTTTAGTAATCGTGGAGTAATGTTCAAACTGGAGTCATCTTTTGA
AGTATTCTCTTGCCACAATTTAACACTCTGAGATAGAGTTCGACAGAGTATACCGTATGG
ATAACAAGGGTTTCTCTTACTAATAAGCGATGCTGTGGAACTGCACGACAGCGCCGATCT
AAGAGACCCTAGCACCAACATCTTTCATAAACACTTAAATTATCTTCTCTGCGTATTTCT
GGACTAGTTTACAACGTTCTCTTTTGCTTAGTTAGAACTCGCTTTCAGTTTCCCATACGT
TCCCTTTCTCTTTCAATTATAGGTTCAAGCCCTAACTTTCCACCTCGCGTAGTCTTTTTT
TTGCATGGAAAATTTTTTTTGAGTATTTAAAGAACAGAGGTTCTATTCAAATTTAACCGT
AGAATATACTTATTCATCTTAAATACCAAGCGCTTCAACCTGTACGTGGATGGTAACATA
TAGATATTTCTATAGAATGTGTTAAGGAACAGGAGTTCCTGACAAACAAAAATAGATCGT
ACTAATACTTTTTTTTTCGAACTATACTGTTTGCGTATGCTTATAAAGCCAAGAGGGGGA
TGTTTGTGTATTACTTTCTTTACTTTTTTCTCTTCTGCATTATTGTTCCTTTAGAGATGA
TAAAGACAACTTACAAGTACAGTTTTTTGTTGGTATCTCATTAACATGATGACTAAGTTG
TCGCCCCAAGCGGATCTTTGAAATGACTGATTTTACAAACAACAAACACTGAAAATTCTG
AAATTAATGAGATATTTACACATTAAACATCAAAAGTTTTCTCAAGGAACATGTATTTAA
TGCAAGAAAAGGATTGCTGAAGAAAGGAATCTTTTCTCAAACATTTTACCTCTTTTGCCT
CATTTGTACACAGCGGTACGGTTGGATTAAGAAAAATATCCATTCGACCTAGTTTTTTTT
GTTAAGCACAATTTGGTTTCAATATCAATTCTTACTGTTATATAAAAAATTGTCTTAATT
GCCATTATCACTCCTCTTTTTTTTTTTTTTTGATGATGATTACACTCCATGCTAATCATG
AACGTGTTCGATGTAAATTTGAATACGATGATTAAAATTGTTGTTTACGCTTTCTGAAAT
CTAAACTAGAAAAGAAAAGGAACTATCAAAGAATTAGGCTCTTCGTATTGGAATTAGTTG
ACAGTTGCTCATGAAATGAATGGATTAAAAAAATAAAGCTGCGCAAGCCCGGAATCGAAC
CGGGGGCCCAACGATGGCAACGTTGGATTTTACCACTAAACCACTTGCGCTTACTATTTG
TTGTTATTCAAAAAATAAAGAACCCACAGAACATAGATTAGAACATAACCTTGGAGTATC
AACTTGATTCACAAAATATTATTCGTCGTATATCATGGCATATAGAATCTTGCTGGAATA
AGAAGCAAGTTTCATCTTTGATCTTATGTATATAGTATTAATATGTATTATTGTTGGAAT
AAAGATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCATATACGGT
GTTAGAAGATGACGCAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCTGAAACGCA
AGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAATGATGATAATAATATT
TATAGAATTGTGTAGAATTGCAGATTCCCTTTTATGGATTCCTAAATCCTCGAGGAGAAC
TTCTAGTACATTCTACATACCTAATATTATTGCCTTATTAAAAATGGAATCCCAACAATT
ATCTCAAAATTCACCCACTCTTCAATTATCATATAGGACAGAATTAGTTGACAAAAAGTA
CGATGGGAAACAGCTATCAAATTTAAAGGAAGCTGAAATGCAAGAATTAATAATGTAATA
GGGTAGCGAACGACAAAGTATAAAAGGAAGGAGGATGAAGTTACATAATTATGTAGCACT
ATCGACTTCCTTTTGGGCATTTCTATAATCTCGAGGAAATCTTCTAGTATATCCTGTATA
CCTAATATTATTGCCTTCAACACAGACGGAATCCCAACAATTATCTCAAAATTCACCCAT
TTTTCACTCTCAAATCTGAATCTAAGTAAATAGTGGCAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved