Saccharomyces_cerevisiae Locus Mono:10:snR68
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:10:snR68
Saccharomyces_cerevisiae
Mono:10:snR68
IX
snR68
1001..1136
2136
CAGACGATCTCTGGCTTAAGTTATGGAAGTTCCTATTACTAGAATTATTATGATTGAAC
AAACTGGTCCTGCTGCTCTGCCTAGAGAGAGAGTTTGCAGCGTTGTTTGACACCGTTTTA
TAAAGGTATGATGGGTCCTCTACATTTCTTTCAAAAATCATAGAACTCTCGCTCATGGAG
GGGGAAGGTGGCATATAATTATTGTCGTTCTCCCTCTGTGCCGCCACGTGGGAGTCGTGG
TCTTGGTTGTGGTTGCTGGTATCCATCTTTGCCGTTTACGTTCGCTTTGCTTGAAGGTAG
TCTATCACAAAAGCTTTCAGGATCAACCTTTTGCGCCTCAAGAAATTGCATATCACCAAA
GGGTGAGTTTAGTCTGATACTGTTTGTTAATCACCTCACGACTGTTGCAACATTAATATG
GCGCACACACCGTGTTACGTGATGAAAATAAAGATAATAAAGCGATAGCATAAATAAAAT
ACCATTTAATACGCTTTGTAAAACAAGCACTAACAAGGCGTTGCTTAATAACAAAATAGT
CAGCATTCAACAACGTGAGAAGGATAGCTACGACATCTACATCTGCAGTGTTGTTAAATT
CGCTGCCAACAACCATTTATATGTCACCATACACGGTCATGCTCTCTTGCACCATTTTTC
TCACCTATATAAAGTGAAAAAGTTTTCGATGTCTCTTCTTCCTTCCTAGTAAACTACACT
CCATGTGTTTCTGAAAGGGACCTTCAGGAGGTTACGATCAAGTATCTTGTGACATGCAAG
AACTTGATGCTTCGATGGGGGAAGTCTTATTTTCAATGTGTTGAAAAGAGTTAATTATGG
AACGGTTGGTCATAGCTTTGTACAGCTCAATGTCGTCATGTTTGTAAGGATACAGGCGCG
ACTTGATCTGCGACTTACTGCTATCAAACGATAAATTATGTTTTTCTTCGTTTCCTTTTT
TTTTCTTTTCAGTTTCCTTCCGTTTATTTTTTTGTTGGATTTATCATGATGAGCATTTAT
TTTACTGCGTTATCGTATTGACGGGGGCTGTTTAAGTACAGTCTGTTTTATAATCTATAT
TCATTTATATTTTATATTTCTTACCGAGGAAATTGACTCTTAACAGATTTGCTGAAAGGT
TCATCTTACAAAAAAATTGGAAAACTTAAACTGAAAAAAAAAAAGTGAAGGAGTACGTGA
AGAGCAGTAGCTTTCATAGGAATATGTACAATATCTTGTCTTTGTACTTTGCAAAACCAG
CACGCAGCAGGAAGCTCTTGATAATATGGTCGATCACCAGTGGACGCCACTGCAGAAGGA
GGTTATCTCAGGTCTGTCCGCGGGATCCGTCACCACATTGGTAGTGCATCCATTAGATTT
ACTGAAGGTTCGTTTGCAATTATCCGCTACAAGCGCACAAAAGGCCCATTACGGCCCATT
TATGGTAATCAAAGAGATTATACGTTCGTCGGCGAATAGTGGACGTAGTGTTACGAACGA
ACTGTATCGCGGATTAAGCATAAATTTGTTTGGAAATGCCATTGCATGGGGAGTTTATTT
CGGTTTATATGGTGTCACGAAAGAATTGATATACAAGTCAGTGGCAAAGCCAGGGGAAAC
ACAGCTTAAAGGTGTTGGGAACGACCACAAAATGAATTCGCTTATTTATTTGTCTGCCGG
TGCTTCCAGTGGGTTGATGACAGCTATCCTAACAAACCCTATCTGGGTTATAAAGACCAG
GATAATGTCTACAAGTAAAGGCGCCCAAGGAGCGTACACTTCTATGTACAACGGTGTCCA
ACAACTGTTACGAACTGATGGCTTCCAGGGCCTATGGAAGGGCCTTGTACCCGCACTGTT
TGGTGTTTCGCAAGGTGCCTTATATTTTGCAGTTTACGATACCTTAAAGCAAAGAAAATT
GCGACGGAAGAGGGAAAATGGGCTTGACATCCATTTAACAAATCTTGAAACCATTGAAAT
CACATCGTTGGGAAAAATGGTCTCCGTCACTTTGGTTTACCCTTTTCAATTATTGAAATC
AAACTTACAAAGTTTCAGGGCCAATGAGCAAAAATTTAGGCTCTTTCCTTTGATAAAATT
AATCATTGCTAATGATGGTTTTGTTGGACTTTATAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved