Saccharomyces_cerevisiae Locus Mono:34:snR86
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:34:snR86
Saccharomyces_cerevisiae
Mono:34:snR86
XIII
snR86
1001..2004
3004
TCAAATAGATTTAAGAGATACTGAGTTTTGGAAACAGGTCGACACCAAGGAAATTTCGG
AATACAACATTGTCGGCAATAATTTCTCTCCTTATAAAGAAGACATATTTGAAGAATGTA
AAAAACTTTTGGGCCATACACTTTATCAGTTGTTTAACAACGTCGGTTGTCTAACGAGTA
TTTGGTGGTTAAATATAAAAGATAGGACATTACAAAATGATATTGAAAAGTTTGTCTCAG
AGTTCATCTCCCCAATTTTGATCAAAAATGAATTTGACGATATCAATTCTAAGATGGACC
GCCTGACTTCTAATGATGATGCTTTGACTATTAAATTAAATAATATTACTAATGAAGTGA
AGGCAAGCTATTTGATTGACGACCAAAAGTTGGAGATTTCCTTCAAACTACCAAAAAACT
ACCCTTTAACAAATATCCAAGTTAATGGCGTCTCTAGAGTTGGTATAAGTGAACAAAAAT
GGAAACAATGGATAATGTCTACACAACATGTAATTACAGGCATGAATGGATCCGTTTTGG
ATTCGTTGGAGTTGTTTACTAAAAATGTGCACTTACAATTTTCTGGTTTCGAGGAATGTG
CCATATGTTACTCTATACTACATGCCGTGGATAGGAAACTACCTTCGAAGACATGTCCGA
CTTGTAAAAATAAGTTCCACGGAGCATGTCTTTACAAGTGGTTTCGATCATCGGGTAACA
ATACATGTCCATTATGCCGTAGTGAAATTCCATTTAGAAGGTAGACTATCGCATATAAAT
TTCATATAAATGTACTACATTTTTTAAACAAAGTTCCTTTTATTATTGTGCTCTCTTACA
AATTATACAATCCAGCCCTATACCTTGCCAATCCAGCCCATCACCCGGATATTCTGGAAA
TTTTTTCTCTTCAGGATTTTTTCAGGATAAAAATCGAACTTGAAAGAAGAATGGTTTTTA
GTTCAGGCCTTGTTTTCAGTTTTTAGCTACTAAAAGAGGGATAACCATTGATGAAATTCT
ATTGAATGTCCCCAATTTTCGGAAAAGGACTGCACCGAAATATTTCAATCAAAATCATTT
ATCGTTTTGTTTAGCTATTTTTTTCTCAAATTATCACTCTTTTCTTCCTTTTTCATTCTC
TCAATTGTTCTTTTTATTTGAGGAAATTTGATTGTATTGCATATACAACTATGCGATGCA
CTTTGTTCATTTTAACTTTGGATATATGTGCCTTGCTATGAACGCGTTCATTTTTAAGTG
ACCGGACCCTAAAATATTCAGGTAGCATGACGGAAGCTATGAATTAATCCTGGTGGAGGG
GTGTGTTCAGTTTGAGGGAGGATGATAAAATGGAACGGAGATTGCAAGGAGACGTAGAAA
ATAAAGTAGGAGCAAATGGATTTTCTGCTTGGCGGTATAGCACGTTTGAGTTTTTCAGTC
GTGTCTATGTTCAGGTTTATGATATGCTGTGGTTGATTCTGTTGATTCACACGTTTCGCT
TCCATATAGTGTGTTAACGGAAACTCCATGTTAAGGTTTATTATAAGAAAATTTTTTGAA
TTTGTTCTTTTTATATTGGTTTACTCTCCTCGTGATTTCTTTTCTTTTTTTATCGTCATC
CTCTCTGAATGTATTTATTACGCATGGCTTTTATTCATTGCTTTCTAACTGTGATGGGAG
TTTTTTTCTTGTTGCATAAATGAACGTGGGCGAGGTTTTTATTTTCAAACTTGGTGTACT
ATAGTGCAATGCGTTGTTAATTGTAATACGATGTTTCTTCGATAAAAGGAGCGGAGGGAG
AAGGTGAAATTACGAAGGAAAGAAAGAGATGAGAAATCAAGAATGAAGCAAGACATTGAT
TGATATGGTTGTTTTCGGTGCATGTTTGATTACTAAAAGTTGGGGCATTCGATGGTTTAC
AGAAGTCATAAATTCAAATATCCCGTTTAATCGCTCATCTATTAAAATCAATAGTAGAAT
GTAGTTTCATACCCGGGAGAAATTCATAGTTTAGATCACGCTTAATAATGTCAATCTTGT
CTTGCTGAAATGAAACTTAAACATGTTTATGTGTAATGTTATTTATTAATTATTAACTGT
ATCTGTAGGAGAAGAAACTATGTATTGTGCAAGTAGTTCAGGTGTTTGCAAATTGATGCT
CTTAGAAAATGAAACGTAGTGTTTATGAAGGGCAGGGGGGAAAGTAAAAAACTATGTCTT
CCTTTAAGTGTTTTCTTTATAAACTCTTTCCACATCTGGCTTGACAGCCGCTAGAATATC
TCTTCTCTTTAATTTTTGGGCGGATGTAACAAGGCCATTTTCTGGAGTCCATTCTTCTTC
AAAGAAAACAATGCCACATAATAATTCAATACCATTCAAGCCTTGAGATTTGGCAGTTGA
CAGCATATCTTTGCAAACGGCATCCTGTAGCTTCTTTTCATGGATATAGCTTTCGACATC
TTCACCTGGTACCATTATACCTAATTCGATAGCCAGCTTAGACAAGTGTCCTAAGTTAGG
GACCACAATACCGACAGGCTTAACTTTGTTTTCATCAGCGTAGACACAGATGTTTTGGAC
GTAAGGATTTGATCTGTAAATGGATTCTAATTTTTCCAATGCAATGTACTCACCATTTAA
GGTCTTAACCAAATTTTTCTTTCTATCAATGATCTTAACTTGTCCCTTGGGGGTCCATTC
AGCGATATCACCGGTACGGAACCAGCCATCATCGGTAAAGGCCGCAGCAGTTTCTTCAGG
ATTCTTATAGTATTCAGAACAGATGGGTGCACCCTTAAACAGCAATTCACCTTGATTATT
CTTGGCAAAATAGCCCAAATCTTCGACATCCACCAATTTAGCTGTAATAGTTCCGACAAG
GTCACCAGCAATACCGTAATCAAAATGTTCAGGCTCCAGGACACAGGCATTAGCCACACC
CTCAGTTAGCCCATATCCAATGAGCATAGGACATAGAAGGTTGGAGAGGAATTTTTGGGC
GTCTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved