Saccharomyces_cerevisiae Locus Mono:16:snR39B
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:16:snR39B
Saccharomyces_cerevisiae
Mono:16:snR39B
VII
snR39b
1001..1096
2096
AGCGGTTCAGCGACTTACAGAAAGCTAGACAAGTGGAAGATAATCAAAATAGCTCCAGA
ACATCTGACCCAGGATCACCTCTGGTAACGGGAATCGATCAAAAAGCCATTCTGGAAGAG
TTTAGAAGAAGATTACAGAGACAAACAGACACCATATCTTTCCTAAAGGATCAAATACGG
CGAGAAAGGGGGCTCAATTGCAGTAACGATAAGGTATCACATTCAAAACGAAAACATGCA
ACCACTGATGGTGATGGGACTTTCAAGAATTTTATTTCCGCGGTTCCCTCCAACATATGG
GTAAAAGCAACAATAAGAATTATAGTCTGTTTCGCTTTACTGGCAGGTGTCCTACCATAC
ATTAGAAAATACGTATATGCTCATGACACACCATCCCAAAACTCAAGGTTACAATTATCA
TGGTGGGAAAATAGTGGCATATTAAGCAAGATTGTATGGTTCTTTGAAGATCAGACAGAT
TTAGAAACTGAATACCGTTCAAATGCCAATGTGGATGACGCATATAGTAGAGTATTCGGC
ATTTAAACCTTGGCCTTTGCACCGTGCCACTTCATACACAGTGAAAATAGTCACGTAAAC
CGTTCATGATATCCTTCAATTCAAAATAATTCAGCATTGATGTGCGTCTACGACAATCGC
TAGTCCTAACTTTATTTTTTTTTTTTTTTTTTACATCTGCCGTCACCCTTGCGATGAACG
AGAAAAAAACCGCCTTTCGAAGTATAAAAAGGATGAACTCGATATTTCAGCAACACATTC
TTTACCTTGGTCTTTTCTCATTTTGTTACAAAAATATATACTTATAATAGCACAGGTTTT
ATTATTTTAGATATGCATAACACAAAATAATGTGCGTGGCAGCGTTGATAATAACGAGCT
AATGTCTTATATCTCATATGAGTTCATGTGATATTTCATGTTACAGCTCAGATGCGTAAA
CTCTCTATCCAAGATGAGGAATAGGATAAAGAGATGTATTTATTTAGTGATGATACTGCC
GATTCTGGCATTCCAAAAAGTGACTAGCAAAATTGCGATGTTGTCAACTTAAATTACACC
ATCTTTCGGGGCTGATATTTAATACATCTATTTTATCCATTCTTCTACGTATTACGTTTG
TAGCTTGGCCAAAAAAATATCTTGCATAATTTGTACTCCAGTTCACATCAGTTGAGTAGA
GAATAGCTACTGATCATATAAACACCCACACATATCTATAAATCCGTACCTTTCCTATAT
ATATATATATATTTTTTCAAATTTTGTCTGAAATTCTTTCTGCAGGTTTGTCGCTGCCGG
ACGCGACTTCTGAGAATCATTGCCATCTGTATCTGTATCACTTTGACAACTTCATCCTTT
CTGAAATATTGAAATAATCAAGACACTAGATCTGCCTTGTATTGTCTTCGGTTCATATAA
ATCCAAATAACCAACCAAGCAAATTAAGATCACAATGGCCGCTGAGTATGTATACGAAAT
CGTCTATTTTATTACTATTTCCTAAAGTATCCAGAGAAGTATACTAGTTTCCGCAAGTTA
CGTTGAGAAAAAGGAGCAATTCTGCTCTAATAGCATTTGCACTCACACTTACATTTATCT
TCAACTTGTGACTATTCACAAGATGATTTTCCGTAGGGGATTACCTTCACAGGGTCAAAG
ACAATTTTAGTTGATGAATTTGAGGAAAAATTTGAAATATCTTGATTGTTGCCAAAAATT
TCATCGCCGACCTTGATTAGAATATTTTCTCAAATTTTCATTTCCTAAGTGTCTCTGTTT
CACTCCCTTCATTCGAATGAAAAGTGGTGTTTTCAATTCGATGTAACTTCGTAGAAAAAA
GTTTTACTTGATGGTCATACAAACCTAATTCATTCTATTTTCGGTTATGCTAACAAAAAT
ATTTTATTATTTGTATTATTACAGAAAAATCTTGACCCCAGAATCTCAGTTGAAGAAGTC
TAAGGCTCAACAAAAGACTGCTGAACAAGTCGCTGCTGAAAGAGCTGCTCGTAAGGCTGT
ATGTTAAACTTTTGCTTACATTTATATTTTATGCTGCAACACATTTTCTTACTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved