Saccharomyces_cerevisiae Locus Mono:11:snR80
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:11:snR80
Saccharomyces_cerevisiae
Mono:11:snR80
V
snR80
1001..1171
2171
ATTTCAAGGCTTCTTTGAGTTACAGTTCGTTACTATTACACCTTAAAGGAACTTTCTTT
TGGGGTCTAGAAAGTCGACAACAAGAACAAAGGATATACAAAAATGCCTCCAAAGTTTGA
TCCTAATGAAGTTAAATACTTGTACCTAAGAGCCGTTGGTGGTGAAGTCGGTGCCTCCGC
TGCTTTGGCTCCAAAGATTGGTCCTTTAGGTCTATCGCCAAAGAAGGTTGGTGAAGATAT
TGCTAAGGCCACCAAAGAATTCAAGGGTATCAAGGTTACCGTCCAATTAAAGATCCAAAA
CAGACAAGCTGCTGCCTCTGTTGTCCCATCTGCTTCCTCTTTGGTCATTACTGCTTTGAA
GGAACCACCAAGAGACAGAAAGAAGGACAAAAACGTCAAGCACAGTGGTAACATTCAATT
GGATGAAATTATTGAAATTGCCAGACAAATGAGAGACAAATCCTTCGGTAGAACTTTGGC
TTCCGTTACTAAGGAAATCTTAGGTACTGCTCAATCTGTCGGCTGTCGTGTTGACTTCAA
GAATCCCCATGATATCATTGAAGGCATTAATGCTGGTGAAATCGAAATCCCAGAAAATTA
GAAAAAAATTAAAGAAAGTTTCAAAGCTTTTTAGTTTTTTTATTGTTTTTGTATTTTAAT
ATGATAATTGCACAAAATTCCAATACGTTTATTTTCTAATTTTTGATTTCGATTCTAGGG
TTATACTTTTTCTATCTGTTTTGTCTCTTCTCTTCCTCTCTGGATAACCACAATGAAGAG
GATAAGTGACACATTATATTTCTATAATGTATTTCCGAAAATTATATCTGCATGTGATTA
TACCCTCCGTTTTTTTGTTTTTTCATTTTTATCTTTTTTTTTTTTTGCTTTTCACTTCAT
TCTTTTTTCTTACTTTGCTTTCCATGCTTGATTCTTTACTATTATTACTAACTTGTGAAA
TAGTTTTCTAATTTGCTTTTTATTAGAAAAGAAACCATCTTGAACGTTTGACAACACTCT
GGGACCAAGTTTCGATGGTTATTTTTTTATTTCCATCGATGTCTTTCACTGTACTTAGTT
CCAATTTATATTGCAAACAAGATTAATTTAGGCGATTACTCACTAAGATATACCTATTTC
TACTATGGTTATATTAGTCCATTTCATAGCCTTACATTTTCTCTTAGTACGTACTCTCTT
GGGATTGGTCTGTTACATTAGTTCGTAAACACTTGTTAATCGTTATAGTTGAGGGAGGGT
ATATCTAAATATCTGAACTTACTTCTGCTAATGGTTGACGACCAATAACTGATTCGAAAA
GTGGAAACTTACAGTTCCTTCAAGGCTACTTTCAGATGCGCTGATGGGCGTGCTTGACAC
CCATCAGCTTTTCAAGTTATGTATACGTTAATTGCAATAATGAAAGGAGGAAAACAAAAC
CTTTCCTGCGTATGTATCTATGGGTCTGAGCAACTTCCCAACTTACTGGCTGCCTCTGCG
GTAAAAACTATCAAAATATTATTTTGCATTGGTAAATATGATAGACCGGACATAAAATAT
CCGCAAAAGTAATAGTCTTCAAAATCAACGGACGCTATCATTTTACCCGGCCTTTAAAGC
GTGAATAACACGAAAAATTTTATTGCGATGGCCAGAATTGCCTTAGAGGGCAATTTAACA
TTAATCTGAGGCTGCGGTTTGCACTTAATTCGAAGTTTGAATCGGGTATCCATTAACAAG
GGTGATTCTTTCCACAAGTGCATCTTTTTGTCCACAAAAAAAATGACAGGGAAAGTCAAC
AGAGACCTTTTTTTTAAACTAGCTTCTGATCTTCGAGAAGAGCGTCTACATGCAGCTGTC
GCATTAATAAAGGACTTATCCGCATTAGATTTGCCCGACGATGCAGAAGAATGGTCTTAT
GTATTGAATCGTTTAATCAAGGGTTTGTCGTCTGACAGAAATAGCGCGAGGTTAGGATTT
TCTTTATGTTTGACGGAAGTAATCAATTTAGCTGTTAATATGCCACCAGGTCAACGACCA
AAAGGTTTAGAATCAACGAACGAGTTCTTGAGCACCTTATCAACCATTTTGAACGTTAAT
GTCAATGAGGGAACAAAAAAATCCATGAAGGGCAAAGATGAGCGTGGAATTTTATTTGGG
AAGTTATTTGGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved