Saccharomyces_cerevisiae Locus Poly:2:snR61
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Poly:2:snR61
Saccharomyces_cerevisiae
Poly:2:snR61
XII
snR57, snR55, snR61
1001..1088, 1231..1328, 1450..1539
2539
TTGACTTTTTTTTCTGAAAGATTCATTCATCAAAGGAACTAGAATATCTCTGCGTATTT
TGTAATATAATTTTTGACACTAACATCAATTTTCACCCTTTCTTACGTCTCAGAACATAA
TATAACATGCCTCCAAAGCAACAATTGTCTAAAGCTGCCAAAGCCGCTGCCGCTCTTGCT
GGTGGTAAGAAGTCCAAGAAGAAGTGGTCCAAAAAGTCCATGAAGGACAGAGCTCAACAC
GCTGTTATTTTGGATCAAGAAAAATACGACAGAATCTTGAAGGAGGTTCCAACTTACAGA
TACGTCTCTGTTTCCGTTTTGGTTGATAGATTAAAGATTGGTGGTTCTCTTGCCAGAATT
GCTTTGAGGCACTTGGAAAAGGAAGGTATCATCAAGCCAATCTCGAAGCATTCCAAGCAA
GCTATCTATACCAGAGCTGCTGCTTCCGAATAAATATAAAATCAAGAAATAAGGTAATAA
GTTGTTTGTCTTCTTCTTTTTTTTGTTTAATCATATAATAATTAAATAGTCATCATTATA
AAAGGATAATTCAACCGTATTATATTACATAGATGCACAAAAACTATTCTGACGTGATGC
GGTCCTGTCCAATGTACGATTTTGGTCTCAAATTGGGCTTATCATATATGATTGAACCCT
AACAAATGCTACAGTGACAATCGTATGTAACGATTATTATCGAACATTCTCTTCCAACAT
CCGAAGAAAATTTTTCTTCATCATATATAAGGATCTTCTAACTTTCTTAATTGAGTTGGA
TGAAAAGCTATCCTTTTTTTTGCTAAGAACAATGCCAGCCAAACAAATTTTGAAGTGGCA
GAAATAGCTGCTATTTTCAGCCACGCCTAAAAAGTGTTGTGATAATTGTCTTTTGTATGC
TAGGAAGCATTGCCAATTATCGTCGATGTTATTTAGGTATTTTTTGATGGTCCTTTACGA
GCACCTTTGATACCGATTTTAGTTTGGGAGATATCGAGGTTAAGCGTGATTATAAAAAAT
GATTTAAATATTTTTCTGAGGAAGTATATGCAGGACATATTGTGAATTAGGAATTCTTCG
TTTATGATCTGGCCTCTTTATTTTCCAACTTAGACTACATCAAAAAGTGCTACGAATTTG
ACACTGATTAAAATATCCGGTTCAATAATTTTCTTCTCATTATTATGAGTTCATAATATA
GTATTGATAAATGGTATATGTTTGGAACTTTTTATTTGATGAATAGACACCACAATCGTC
TTTTTTTTATCCGGCGATGATTCCTTTGGAATATGTGCCATGGATTACATCATGCATCAC
CATCTGATTTTAACCCATTATATTACCTGGATTTTCATTATTTCCATTGTTTATCAATAT
TGAAGAAAATTAGTGATCGGTCAAAGTGATATTATATAAAGTTATACCTAAATCAAGTGT
GGAATGTTGTCTACAATGATGATAAAATTTACTATTCAGTTCTGCTTCTGAACCAAAATA
ATAGGAAGATAACCAATTTTACCAAAGCTCAAATCTGATTTTGTTCAACATTCCTTGTAA
TTATTAATTTTCTTGCATTCGTACGCTACTCTAATTGCAGTGAAGGATCCTTGTACCACC
AGTTTGTTGGACAGTTACATCTTACTAAATGCATGAATTGTATTATTTATTAACATTGTC
TTGCTTTCTAGCATCATTAACATGTTTAGCAATTAGAATTCATAGTCTTCATTTGCTGGT
TAATAAGCAAAGCATTGCTCAAATTTTAAAGATGCTTTATTGTATCTATCTCCTGAAGTT
GTCCATATTTTTTTTTTAAAGTTTAAGTTTAGTTACGGGGTTTAATGTAATGCGAAGGAA
CCTAAAAGAAAGGCTGAAATAATCAACCAATAAACAAACCATTAAAGAGGTGGAAATAAT
TATGATCAAAGAAAAGCAACTTGGGTTATATTCCAAATGAAATAACAGGAAAACTTTAAT
AGAACTCTTCTGTCGAACTATACCTCTTGTGGCTCAAAAAAAAAAAAATGAAAAATCTCC
GCGACGGGGAATTGAACCCCGATCTGGCACGCGACAAGCGCCCATTCTGACCATTAAACT
ATCACGGATTATATTACATTAGCGTTTCCTGTGTCAAAACGCAATTCATAGTAAGGTGGT
TTGACAATCCTAATATAAGCAGTCTTGAGGAAGTGACCAGTTGTCAAAATGGATTATCAG
CTTGATTTACGAAATGTTACTTATCCTATATACTACATAAATATGATTCATACTAAATGG
TGGAAGCGCGGAACCTCGGATCCAAATTAATTGTTCAGGCATTTATATGTTTGGGTGGGT
CAGCCAAGGAAGGCGGAGTTTTATCTCATGTTACTCACTCTGTTCGTTTTCTTATAAGGT
TGTTTCATGTGTGTTTTATGAACTTTTAGGATGATGTATTGTCATACTGACGTATCTCAT
TCTGAGATACGACAGCCTTCCACCGAGATGTAACCTAACCAATACAATACAGAAAGGAGA
TCGAAACTCGAATCTGTTCG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved