Saccharomyces_cerevisiae Locus Mono:37:snR58
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:37:snR58
Saccharomyces_cerevisiae
Mono:37:snR58
XV
snR58
1001..1096
2096
TTTAATGACTCCGACTGTATTGGTAAGTTCCATTTTGCCTCCATTCAAATTGCTACCGC
ATTCCCAAGCTCATTTCCTAATGTGTTAGGCTTGCCTGATAAGACACCATGTTTGATTCC
ATGTGCAATTGACCAAGATCCATATTTCAGAGTTTGTAGGGATGTCGCGGATAAATTGAA
GTACTCCAAACCTGCTTTGCTTCATTCCAGATTCTTTCCAGCTTTGCAAGGTTCCACGAC
CAAAATGTCAGCCTCTGATGATACCACTGCCATTTTCATGACCGATACACCAAAGCAAAT
TCAAAAGAAAATTAACAAGTACGCATTCAGCGGTGGTCAAGTGTCCGCCGACCTACATAG
AGAATTAGGTGGTAATCCCGATGTCGATGTTGCATACCAATACTTGTCATTTTTCAAGGA
TGACGATGTTTTCTTGAAGGAATGCTATGACAAATATAAGTCCGGTGAATTACTATCAGG
TGAAATGAAGAAACTGTGTATCGAGACTCTGCAAGAATTCGTTAAGGCGTTCCAGGAACG
CAGAGCTCAGGTGGACGAAGAGACCTTGGACAAATTCATGGTCCCACATAAGTTGGTTTG
GGGCGAAAAGGAAAGACTTGTCGCACCTAAGCCAAAAACTAAGCAAGAAAAGAAGTAAGT
AGTCACGCTTATTCTGACGCTATTATATACAATGATATAGAATCCGAAATTGTAGTTTAA
CACTAAAAAAATAATGCAATAGAACAATAGTGTTGCGATGTCTCCTGACCTCACTATTTC
TATAGATTGGTATGAAAAATTTTTTTTTCAAATATATGGGAAAAATTTTTCACGGCATAT
AAAAGACTACCATCTTTCTGCATCAGTGTGCCAGACCCATTCTCACACCAAGAAGCGAGG
AAGCTAACAGGCCAGTACTTGCAGGTTAGGTTTTCGTGCTCAGATGAGCAGATCATGGAC
TGCATTGTGCTGTTGTTGCACAGTAAATTTTGTATACCATACTTTATGATGATATTCTTT
ACGAACTTTTAGACGTTAGACTTCTGAAGGAGATTAGACCCTCCTATGGAAGAGAAACTC
GTTAAACTTATCTGAGTAGGTATGTGTATATGCGTCTCTTGTATTATACAAATGTTCTTA
TTTCTTGTCCTGCATTTTTCCGAGTATTGGTAAATTCATGTAAATTTTTCATCCCATAGA
TCGTAATTTTGAAGTAGTGGCAAAAGATTTTAACAGAGCGTAAGATATAGTGAGAGAAAC
TACTCGCTGAAAAGTTGAAAGTGACCCAAAAAACGGCACGAAGACCAATTATACGCACTT
TCAACACAGTTCGTCGAATCTTCACAATGGGGTTCAAGAAGCTCGTATCATTCCAACCGG
ATTATGTCCCACAATACCATATAACTAAATATATCTCGGAACGAACTAAACTGCAACTGG
TACATATAAACCACAAAACCTCCCCATTGGTTCACGGTTACTTTGCTGTTCCTACAGAAT
GTCTTAATGATTCAGGTGCTCCGCATACCTTGGAGCATTTGATCTTCATGGGTTCTAAAT
CTTACCCATACAAAGGTTTATTAGACACAGCTGGTAATCTGTCTTTGTCTAACACCAATG
CTTGGACTGATACCGACCAAACTGTTTATACATTAAGCAGTGCTGGCTGGAAGGGATTCT
CAAAGTTGCTACCTGCTTATCTAGATCACATCCTACATCCAACTTTAACAGACGAGGCTT
GTTTAACTGAGGTTTATCACATCGACCCGGAAAATTTGGGTGATAAAGGTGTGGTATTTA
GTGAAATGGAAGCCATTGAAACTCAGGGCTGGTACATTTCAGGGTTAGAAAAGCAGCGAT
TAATGTTTCCTGAAGGAAGTGGCTATCGGTCAGAAACTGGTGGGCTAACGAAAAATTTAA
GAACCTTAACCAACGACGAAATCAGACAATTTCACAAATCTCTGTATTCTTCTGATAATC
TTTGTGTCATTGTTTGTGGTAACGTACCAACAGATGAACTGTTAACCGTCATGGAAGAAT
GGGATAACAAATTGCCGGAGATTCCATCGAATATACCAAAGAAAAGACCATTTTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved