Saccharomyces_cerevisiae Locus Mono:15:snR10
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:15:snR10
Saccharomyces_cerevisiae
Mono:15:snR10
VII
snR10
1001..1245
2245
ACTGGCGGTAGCGTTACTGAATGGTAAAAAAGCTATGTCATGATCACCTCCGAAATCCA
AGTATCCAATAATGGCCTCGGCTGGCACCTGAGCGATATCTTCATCGGAACTAGCAGTGA
CAGAAACGGCCGCTAAAATAAAAGTGAGAAAGGTAGAAATGAATTTCATTTTCTCCAATA
TGTGAATTTACTGGAATTTGATGCAGGTGATGGTAGTAATTATCCATTATATAGAATATA
AAAACAGATATAGGAAGGACACCTCAAACTACACCAGAATCAAGGACAGCTTTTATACAT
ATAAGCCCTCGTCTCTGCGCTGTAAAGACACCAAGTTTCACTAGGTCCACGGCGACTCTG
TACTGAAACAACTGAATATTTGAAACAGTAACGATGAATAGTTTGGCTCGATACCTTGAA
AACAATCACTACAGGCGTCGCCCAGATGCGCACATCGTTGCTGGCATTGATGTACCAATG
AAGAAATATAAGTGACAAACTTTATGAAAAGATAGAAAGAGGTTTACAAGATAAGAGAAA
AATTATGCTGTGAAGATTAGTAATCGAAGTAACTGCTTATTCATTCAGTGCATGTTTTTC
TAGGAATGCGTTTGATATGGGACATACATCTTACTATGCGACATTACCTTTTAGGGACAT
CAATGAGCAAGTGAACACTAGCAAATTAGGAAAACAACTTTAGCACGCCCAACTGCGTAC
TGAAACGCAGAAAACTATAGAGTTTCCCGAAACGGTGACAGCTGAGTTCGCTCAAATAAG
AACAACACCATGTCTTGAAGCTTCTTCTATAGCGTAGAGTAAGTAGTGCCTTGTAGCCCT
ACCGTTTTACAATGCATGAGGTTACCCGCACTTATTATTTTTTTCTCTTTTTTTTTCTTA
GCTATAAAAGGCAGATCAATGCAGCATTCATTGCTTTATTTGACTTTCCTTTACTATTTA
TTTACTTTCCATTTCTTATTTTAGTGTTATTTTATAACAGTAACGCAAATTTAACAGCCA
TTCGTAACACGTACAGTATCTCGTCGAGGTTGAACCCCTCCGGGGCGTTCTTGACCCATG
AAGAATGTGGATTGGTGTTGCAATATATTTATTATTGGCTTGGACTGGAGAACAAATTTA
TCGATCTTGGGTGCAACAGTCTTTCTGTCGTCTGTTTTTTAGCAGATCTAAGGGTTTACC
TTCGTGTGCCCGGATGAGGACCGTTGCAAGGATTGATAATACAACTATATACATCATTAT
CGTAGTGAATTGCACGAGTAACTTCTCGGCATGGGGTGAGTAAATTCATATTATGAAAGT
AATTAAACTTACTACCTAAATAAGAGGATATCTATGTCTTATTGCTTGTATATATGAGTG
GCTTGGAATGCTGCAAATACTGTTTAGGAAAAAGTAGATAACTAAAAGGTTTCTCCTTCC
TTCGGTTGACGCAATTTCTTGTTCGCTGGGGTTGCCATTTCCTTTCTAAGATCAAGTAAT
AAAGTTTCCATGGTGTAGGCTCTTTTCCAGTCACGTAAGGTGTGGAAGTCAGTTTGGACC
TCCCCCGTAGTTGGATTGACGCATGGTAGATTTATCTTGGAAATGAAAGTGACCTTTGGG
GGAGAATCTGGATAGTTTGGGCCACAATCTATAGAAAGGGAATAGATTCTGTTTTCATGA
TTACTATGAGGGGGCCCTAAAATAGTGCCGTTCCATTTGGTCATGGTAATATCGTCGCTA
TCAGCTAAACCATAACTACATGATTCTGGACCAAACCCTTTTTCACCCTTTTCTAATTCT
TCTAACAACCTAAAATTTCTTGGTCTGATTTACAATAGGACAGTGAGGGTACATTTCAAG
AATTTGTTAGTATATGTTGAAATCCCTTTCAAAACTTATAATAACATACACTTTTGACAT
TTTTGTGTAAACGCTGCTTTCTTCTACGTTGCATATACAGAATAAGAATTTCACCACGAC
ATCGAAATGTAATGAGCAGAGATTGTGTAGGAAGTTGATCTTATTTTAGTCTCTTATTTA
TCGCTAAAGGAGCAATGAAAATTGATAGCGTGTTACCCTAGGAATAATTCCTAACAATTT
TTTCCATCTTAAAATCGAGAGGTAATAGTAAATAATGGATGTGAGAGCGGCATTGCAATG
TTTCTTCAGTGCATTGAGTGGACGATTCACTGGAAAAAAATTGGGACTAGAGATCTATTC
TATCCAGTACAAAATGAGCAATAGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved