Saccharomyces_cerevisiae Locus Mono:27:snR42
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:27:snR42
Saccharomyces_cerevisiae
Mono:27:snR42
XI
snR42
1001..1351
2351
CTTAACACCAAAATTTTGCTGTCTTCCTCCAGTTGGTTAATCGTTTCATCGCATTGTGG
CCAACCGTCTTTCAAGTCTTTGCAGGAAATACCTTTGAATGTTACTTGTGAACGTAACAA
CTTCAGCAGTTCCGAAGGGGAATGGACATCGTAGGTGGAAAGGTATTTGAAAGTCCCCTT
CTTGGGGTCAAACTCTATTCTATCTAATTTTTTTAAAAGCTCAATAACCTTGTCATCTTT
TTTCATTGACAAGTAGTCCAATAACTCATTCACCAAAACGGGCTTACCTTTCTTTTGAAT
GTATTCAGTCGCCCAAAGCAACTTTGAAGAATCGTGACTCTTGGAAATATCTGTTTGATT
TGCTTGTAAAGCGGCTGCAGCAATAGAGCCAGGCCTTACTTTTTTTGAAGGAGAGCTACC
AAAATCTTCGTCGTCATCGTCGTCATCTAATGAAATAGCATTAGAGCTATTGCTCCCAGC
TTCTTTCTTGATATCCACTAACACAGGATTTTTCGCAGAGTTCAAAGTGTTTTCTTGCGC
ACGTTCGGAGGCCGTCCTCTTCCTAGTGTTTCCATCTATAGTAATCACTGTGTCATTGGT
CTTCTTCTGTCCAACTTTAGCGGGTGCGATCACCGGGGCAGACTTCACTTTGCTTTTGAA
AGCGTTCAAATTAGCCAGTAGAGGGTCCCTGTTTTTACTCATCGCAAAAGACTACTCTCT
TTTCCAAATCGAACGAACTACTTGGTATAAAACAGTTCTGTGTAACAGCTTTCTCGTGTT
CTACAGAGCACACGGTTATGTAACTAGTTCACTTCTTATTAGCTCTTTTGCCCTGATTCG
TAAGTGAACTTCTTACCCGAAGTAAGCTCGCGCTTTTCTTTTTCTTCTCGCATATAACAT
TTTGACTATAAAAGCCGTGAACTATAGCATTTGCTACCAGAAAGAATTTTTCTTGCCCTG
GACCTTTGATGCTTTAAAAAACATTTCTCTTAAAAGAAAGCATAACAATTTGTGATGCTT
TAGGGAGCCTATTGTTTGATGGTTTATAGGAGCCGGATTTGTCTTTTTGACTAATTTTCA
ACCTATTCTTACTTCCAAAACTGTTGCAATGGCTCTCGTTTTTTTTAAATTTTTCTCTTT
TCTCTTCTTTGGCATAGTTTATTTTTAATAAATTATTTCAGGGTGAGATAGAGAAAGGAT
AATGAGTATCGTAGATAAATCTTCGGTTCCGAATAGTGTAACTGTTGGTGCTGAGGTAAT
CCATCTTTAAAACCATCGCCGTTAGAGGTTGCTTCTGATATTTTCGGTTAAGCGACCCAT
GAAATGGTGATGACCTGAGGTATGGAACATCTTTCTTGATGGTTACTTTGTTATATATAC
GTATTTATAGTATGCGGATACACGCTTTTCTCGCTATGAATCGTGTTTGAGGAAGTATTT
ACCGCTGCCGTCCTTCCACCATCTTCTCAGGCAGCTGATGACATTGAGATCAATATTGTC
TGGGTGATTGCTATCACAAAGACATCTTTGTTGAAGTCTCAGGTAGTATGCAGATGGACA
CGTGCCAAAAGGCATATGCTTATAGCCTAATTCATCAAAATGGATGATTTCGTCTTTTTT
CAAAAGAAGTGAGGCAGCAATCGAATGAACTGGTGCATCTCCCCACCTTTCATAGTAAAA
ACCGCCCTTTGAATCCAAGTACTCGAAAAATCTAATGTATTTCTCACTTCTGAAAAAGTT
CAAATCGCCAATTTCAAAATTTGTCCAAAAATGACATAAATTATAGCCGCTGTTACTATC
GATGACACCAAAAGATTTACCGATGAAGTCGAAATTTGATACGAACCCGAAAGCGTTGCT
TTCCATGTCAATATCTGCTGACTCTGTTTCTTCGAGATATTCTTCTACAGCTTCCCATAG
GCTCGGAATTGTATCTTCGTATTCATACATAGTTATCACAAAGCCATATTTCTTATTGTT
CTGCCTCATCACCTTGAATGGATCGTAGGGAAAATCGCAAAAATACTCTACATCTGGCTC
AACTCTGAAATAAAAATCGTACGGATCTAATATCTTTTGTCTAAAGAAAAATCCAGAATT
AAATCGGCACATATTTCTATATGACTTTGACCCACCGTACAAGATATTTTTTTCCTCCAT
TAATTGTAAAGCCTCTTCAAATAGAGTTTCGTTGATCCAAGATGGCCTGTTCCAGTCCTC
CGCAGGGATTAAAGCGTATTGCGTTCTACCACTAGCCATGGCTGTGGTGGCTTCGATGAA
CTCTTGATCAAATGGGACATCATTAAGAAATGTCCAGTCATACTGGTAGTTTTTATTGAA
ACGGTCTTCTAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved