Saccharomyces_cerevisiae Locus Mono:5:snR189
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:5:snR189
Saccharomyces_cerevisiae
Mono:5:snR189
III
snR189
1001..1189
2189
TAAATCAAAGCTTTTCGAAAGTGCAAAACAGGTATAGTTATTGAGTTCGCATAAGTCAT
CTTCAACTGTGCCTTTTTTGCTATTAATAATCATATTATCCTGTATGGGATAACCTTGTA
TTATCTTGGTTAGTTCATGCTGTACCAAGTTTTCTACATCTGGTTCAACTTCGTGATTAA
TTGGTTGTAATATCAGTATATCTCCTAATATTATAGTAGCCTTCTTCACATCGTCTTGGA
GTCTTAAGACTTTCGAAGCAGCATTAATAATTGAATTCATATCCGTATTGTGTTTTTTTT
TGGCAGAAAGGAGAAAGAACCAATTGGCTTGCAGTTCTTGCTGCTATAGTCCTTTTATGA
GTTCTTCAAATGATTTATTTGGGTCAGTTGAATCAGTAATCACATCAACGAGATTCTATT
GTACTGGAAAGGGGCCGATGCAGTAGGGACAAATGCTATAGCTTTGAAGGCTTCTTATTT
TCCCCATTACCCGGATTACAAAGTCACTACCTTCATCACCCGTACGAGTATTAAGTAATA
ATAACTAACAGTTTGGAAGGCTCTATATTTTAGTCTATTTAGTTGCTCTTGGTCTTGCTT
TATTATCAAGTCTGCACTCTTCCTTTCTTCTAGGCATATATCGCCTTATCAATGGGCTGA
AGAAAATAACCGCTGAAGTCGAAATAGATATGACAAGTTGCTTCCTGTCTTTATGGTCTG
AGAGCAGTAAAAAAGCTTCATGGTAACTTTATTAACATACCGCAAACAAAGCTTTGCAAC
GCAAATTTTTGGTGAGCTTTTGCTTCAGCAATGTATTTTCTTTAAGCCATGCATGAATCA
CATTGTTACCTGGCAAAATTATTGAAAAATATTATCAAGGGCCGGGTAATATACCCAGAT
ATACATTTTTTTTTCCTGTTCTTTTCTTTATAAAGTGAGATCCTTCTTTTATTGATTCAC
TGTGACCGTTGTTTTTTCAACTGTGAACTTATAAGAAAATTAACAAAATAATTTACATTC
CAAGGACCGGTATTATTGTAGGGGATTTGTGACTTTCAAGGCAACGTCCTCTCTACAACC
GAGTTCGAGAATAAGTACAAATGGCTCTTTTTGTTATTCGAAAGCTTACAAGTTCTGGTA
TATTCTATATACTCACTTATTACTTTCAAGTACTTCACACGGGCCTGACATCTCTATTCT
TGTTACTCACTGATTATCGTTCTTGTTCATACTTGTTATGTATCTTCTTTCTCCCTATTT
AAAATGTAATAGAGACTGCTTTGGAGTACTTACGTGCGGTGTACGGACTTAATAAACATC
TGTACATTTTACTACTCTTTTTTTTTGCGTTCTTTTTTTCACCTTCAGCACGAGCATTGC
CATTCTCTACTGCATTTTGGCAAATTTGTCTGCTTGCGGCAGACCATCCCGCCTCCTGGC
TCATTCCATATGGTGCAGGGCTTCCTCAGGTAGACAGTTGAAATGAATTGGTTATTAATC
ACTATATATTACAGAAAGCACTTTTTAATGAAGATTCTATTTTAAACCCAAGGAGAGTAA
GAAACCACAAGAACCCGCCATGTCTAGTATGTTTAATCACATAGTGAACATTTTTAAAGC
ATCTCTATTTTCCATTGATTGTTGTTGAATGTTTCTGACGACGTGCAAGATACATTGAAA
GTCAGAAACATAAAGACAATTCAACGAATTCATTGCCTCCAAAGTAATTCATAGCGATTA
GTTGAGCCTATTGTGTCAATGGCAGTATATTTTGTCAACTTTTTTTTCGATGGAAAAGCA
AAGATACTATGTAAGAATTAAAAAAAAAAACTTTTGGATACTAACAACATTACGTTTGAT
ATCGTCCGATATCGATTTACTATTTCCATTTAGACGTTGTTCAAGCTCGTGACAATTCCC
AAGTTTTTGGTGTTGCTAGAATTTACGCTTCTTTCAACGATACTTTCGTTCATGTTACCG
ATTTATCTGGTAAGGAAACCATCGCCAGAGTTACTGGTGGTATGAAGGTTAAGGCTGACA
GAGATGAATCTTCTCCATACGCTGCTATGTTGGCTGCCCAAGATGTTGCCGCTAAGTGTA
AGGAAGTCGGTATCACTGCCGTTCACGTTAAGATCAGAGCTACCGGTGGTACTAGAACCA
AGACTCCAGGTCCAGGTGGTCAAGCTGCTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved