Saccharomyces_cerevisiae Locus Mono:14:snR82
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:14:snR82
Saccharomyces_cerevisiae
Mono:14:snR82
VII
snR82
1001..1268
2268
TGACTGTCCCGGTCTTGTCTTCCCAAACTTTGCATATAACAAGGGTGAGCTCGTGTGTA
ATGGTGTTTTACCTATTGATCAATTACGTGATTATATTGGTCCAGCAGGTTTAGTAGCAG
AAAGAATACCAAAGTATTACATTGAAGCGATTTATGGTATCCATATTCAAACCAAATCAA
GGGATGAAGGTGGGAATGGGGATATACCAACTGCTCAAGAATTGTTAGTCGCATACGCCA
GAGCTCGTGGTTATATGACTCAAGGTTACGGTTCTGCTGATGAACCAAGAGCAAGTCGTT
ATATATTGAAAGATTACGTCAATGGGAAATTACTGTATGTCAACCCTCCGCCCCATCTAG
AGGATGATACACCTTACACTAGAGAAGAGTGTGAAGAATTTAACAAAGATTTATATGTGT
TCGACAGATTACCGGACACCAGAAAGGAGCAAGTGCAAAATGCTGCTAAGGCTAAAGGCA
TTGATATCGTGGATTTAGCTCGTGATTTGAATCAGCTAACGTTTTCAGCTCACACTGGTG
GTGACACACAAAAAGAAGCCAAATCTGTTACGCACGGTGGTAAACAAGCTGCATTGTACA
ATGCCGCTGAGGACTTGGATAGAGACTTCTTCAAGATGAACAACGTCGAAGGTAGATTAA
GTACACCATTCCACAAAGTTCAAAATAGTTCAGCTGGTAAGAGACATAACAAAAAAAACA
AAAGTAAAAATGCGAAAAGCAAAGTTTTTAGCATTGAAAATAATTAGCGGTAACTAACAT
ATATCTTCTCAAAAAAACTGTGTACTATTATCTTTTCATCTCGCCAATTAATGACAGCGT
TATTTGAGAATAGACCTAAGATAATAAAACTATGTTCGTTACCCGGACAAATTTTCTTGG
AAGAATTTTTGAGTCCTAGAGATATTATAAAACGGCCCTCTATTAATTTGCTCTTTCTTT
CCTCAGTTTAATTCTTCTTTCGAATAAAAAATAAAAATATCATGGCTCTTCAACACATTT
CAACATGTTCAAGTAATTTGTGTTAGTGGATGACCATTTAGGGGCTGCTGGCCTGGTTAC
CGGGAGTTTTTCTTGGATCCAAGCTAGCTTTTCCGTCTGATTATCCTTAAGCTTCACAAA
TTACAATTTTTCCCACGCATTAAGAAATAAGCTCAAGATGCCTAAAATAAGTTCTATCCC
GCCTTTTTTCGCTAACAATGACTGAGTATTCCCACAGTCTATAGTTTGATAGTAGATGGG
CGGAAATTTTTCTCATATATTTACTTTTTATAGGAGAGTATATTTACGTACGTATAGTGA
TTGCATGTAGTTGCTCCCTATATCTTGTCATATGAGCGTGATACTGACCGATACCTGTTA
CAGATGTCGGTCTGGATTTGTTCGTTTTTCTTCCCTAAAGTAGGTCAGTATATATAAAAT
ATGGCCGGAGGAAAGCTTCACCACTTTATCACCACTAAATTTATAAAGTAGAATACAATT
TCAACATACACAGAGAATAAAAAAAGGTTGACAGGACACATAATAGCAAGGCAAGATGGC
TGAAACTTCCAACGACCCCTTTCTGTCCTACGTTTTGAGTAGCAAACAATTAACTAATTT
GAATCGTCTACGAAGGAAAGCAGTTACAAAACAACTGGGATCAAGTGACGACAATAAGGT
CTCAGAGGAGTTTTTGAGGTATCAACATACTTATCAAAGAGAAGCATTTGAATATCTGCA
AACAAAACATGACGCCCACAAAATAATGGAGTCACAGTACGAACAGTACCAAAGCAGTTC
AAAAACAAGAAGATATAGTATCGATTTAGATTCTGTAGATGCAGTTGACACGGAATCGCA
AACAGAATACCCAAATGAGGAGTTTATTGATAGAAACGAAGATAGCGAAGCTGTTATGGA
GTTGAGAAAGAGATTGTTGGGGAAGGGACAGAATAAGGGTTTAGGATATGAAACTACGAA
ATCAGTCGATAGGCAAATTGAGGACCAGGACACGTTGCAACAGGATTTGATTCAGGATAT
GAGCAAACTTGTGGGCAGTTTGAAGCAAGGAGCTGTGGCATTTCAATCAGCACTTGATGA
AGATAAGCAAGTTCTTGGAGCTGCAGAGATAGGTATTCAAGTTGCTTCTCAAGGTTTAAT
GGATGTTAGCGGTAAATTAAGGAAATATGACAAGAGTAAATTGAGTTACTTGTTTTATAT
TACTGTTTTCATTTTTATGATTCTCGGACTGGTGTTTACATTTATCATA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved