Saccharomyces_cerevisiae Locus Mono:4:snR65
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:4:snR65
Saccharomyces_cerevisiae
Mono:4:snR65
III
snR65
1001..1100
2100
TTTCCTGCGGAGTCAAAACATTACTTTCAATCATTTGAGCGTTTAAGATCTTTGTTATA
TCTTCATTTTCAGCTATTATTTTTCTCAATTGCTGAGCATAGTTCCTCTTCAGATTTGCC
AATTCCTTAAATAACAGGTAAAAGTCTTTATTCAACAATTTGACCTGCGATAACCTGATT
CTAATAGTTTCGGTAGCCTCGTAAGGACTCTTAGTAGTCAATATGCTATCTGCATATTTG
GTTCTTTGTTCCGTCATGAGAGGTGATTATTCGCAATTTTCAAATAAGCTTGCTTCAATA
CGACTACAGCAAAAGTAATTCCTTTATTAAGGCAATAACTACGAGACCTTTTCTTTGTAT
TTCGTGAAAACTTGAATGCAATATAGAGTTTTTCAATCTGCAAGTACTTAAGGGGCCCTT
TTAGCTACACATAATATAGAAATGAAAGATCACGGGCTACGAAAAGCCATTCATAATCAT
ATACAAATATCACCTGTAATATATAAGAATATATGAGCTATTGATTTTCTTCTACCGCCT
GATTTAGTTGTTTTCACTCTTCAAAACTAAATTCAGTATTAGCGACAGTGGAGGTGCTAG
TACTCTGTAAATGAAAGTAAACGCTGGTATTCATGTAGAGCACCAACCTGACTGTGAATG
CGTAAGCTGAAACATGATAGCCGCCTGTAAAATATTGTTATCAATAAGTAGACCGGCTTA
CACGAATAGGATTCGCTTTATTCTTTACTCCCCACTCAACCCTAAGCAATGTTCAAAATA
GTGTGAGATTATTTTATGCGCGCCTCCTTCAAAAAAAAATTTACATATATAACATAGGTG
GAAAAACTTCCCTCCGATGTCTAATAAGTTAATCAATAGAATGAAATGGACACGAAAAGG
CGTAGACATGGAAGATGACAATGACGAGAACGTCATTTTTTTTTCCACGTATTTTAAAAA
GGGGTAGCCTGCTTCACCAGATGTTCTTGTCAACAAAATTCTAAAATGATGATTTTTTTA
AACACAATTTATGCTAGATAGTATCTGAAAGCATTCAAACTTTATGATTACAGTGTTTTC
GACAGTTTTAAATCTCTGAACCGATTTTGTAACTCTTGGTAATTGTGTCCTTACATTTCC
GTAATGACGTTAATCAAATCGCAATCTTGAATCTTCTTAACTAAAAGGTTATAAGGGCTT
TTTTTTATTACTAAATTGACGTATGAGCTGATTTGATTATGGGCGCTATATAATTATATG
TACACATTTTTTAACTGTAAAAAATAATACGGCAATACAAGTACAATACATGCATAACTC
ATAATCTTCTACCTCTTCTACCACCCTTCTTTCTGGTGGAGTCAGATGGAACTGGGGTAA
CATCTTCGATACGGCCAATTCTCAAACCAGATCTGGCCAAAGCTCTCAAAGCAGCTTGAC
CACCTGGACCTGGAGTCTTGGTTCTAGTACCACCGGTAGCTCTGATCTTAACGTGAACGG
CAGTGATACCGACTTCCTTACACTTAGCGGCAACATCTTGGGCAGCCAACATAGCAGCGT
ATGGAGAAGATTCATCTCTGTCAGCCTTAACCTTCATACCACCAGTAACTCTGGCGATGG
TTTCCTTACCAGATAAATCGGTAACATGAACGAAAGTATCGTTGAAAGAAGCGTAAATTC
TAGCAACACCAAAAACTTGGGAATTGTCACGAGCTTGAACAACGTCTAAATGGAAATAGT
AAATCGATATCGGACGATATCAAACGTAATGTTGTTAGTATCCAAAAGTTTTTTTTTTTA
ATTCTTACATAGTATCTTTGCTTTTCCATCGAAAAAAAAGTTGACAAAATATACTGCCAT
TGACACAATAGGCTCAACTAATCGCTATGAATTACTTTGGAGGCAATGAATTCGTTGAAT
TGTCTTTATGTTTCTGACTTTCAATGTATCTTGCACGTCGTCAGAAACATTCAACAACAA
TCAATGGAAAATAGAGATGCTTTAAAAATGTTCACTATGTGATTAAACATACTAGACATG
GCGGGTTCTTGTGGTTTCTTACTCTCCTTGGGTTTAAAATAGAATCTTCATTAAAAAGTG
C
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved