Saccharomyces_cerevisiae Locus Mono:18:snR48
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:18:snR48
Saccharomyces_cerevisiae
Mono:18:snR48
VII
snR48
1001..1113
2113
ATTGGAATTTAATTGATCTTGTAGAAAGTACCGAGGATTATTATGAAAAATGCAGATCT
GAAATGCTAAGAACTAGGCTATTAAAGGCCAGAGATTGCTTAACAACGAAAAGTGTTGAC
ATAACGGAAGAACAAAGGAAATTTTTGGAGGAAGAAATGAACTTCGATGAAATCGAGGAA
AACAAACTCAAAAATTACAAGTGCTATGAAATAATTAATAAAACGGTCATGGATAAGGTG
GCTACAGAATGGGATCCTGAATTTATAACTAGACAATTAGAAGCTAAGAAAAAATTCAAC
GAGCTGTCCAACAGAGAAATTTCAAAATTTCGAGACTGGAAAAAGAGCCTATTCATGGAA
CAAGAGAATTTTAACCAAGAGATTGAACAATTGAATCACAAGTTGGAAAACTTACAACTG
GAATGTCAGGACTTGGAATACAAGCTGTTAATCGGAAAAAGTTCCAACAGCCATTCCACA
GATAGTGCTACTTTAGTAAACGTTCACATCAAAAGGTAGTATTAATTAAAAAAAAAAAAA
AGCCAATAATTTCGCGCAAGCTTTGCTCTACATAATAAAAATACAATTAGGATAGAAATG
AATATTTTTTTAGCGGCAGTTTTACCATAAGTAGCAAAACCCTAACAATACAATGTGAGA
CTAAAGTAAATCCGGGTAATACAAAATACAATTTTTTTTTATTCTTCACAGCGTTTTTTC
GACGGAGGAGGGAAAAAAAAAAATTGTATTTAAGGCATCAAATGCGCGACATCATATACC
TTTGTCCGCTGTTATCATACCTTGAACCTCTACATTTCAGCCTAGCGCGCGCAAAAAGAA
AAAAAAATCATAAGCAAGAGTGGTACGGTAACCACAAGGCAATGCAAAGAAGGGTGCGAT
ATCAAGTGATGTTACCTTCCTTTACTTTTTGCCTTTTTCTTGAATTGTCAATCCGCCCTT
TTTTTCTTTTCAGTTTTTTCTCCTTTCATCCGTCTCGTTTATCATAATGATGATTTCACT
TATACCTATATGTTTTTTCTGGCATCTCTAATGTTAGGATGTGAAGTTTAAGTACTCTCC
ATTCAATGAATACAATTTTTGACAATATCTGATTTTACTATGATTAAACAGACCGAGGGA
GAAAAAAAAAAGGAACTAAAAAAGGGCCTACGTAGAAGATGATGTAAAAGTAGATTCGCA
TCTGAGAATGTTTTCTTCAAATTTTTCTTTTCGGCCTTGGCGCAGAAGACTTTCTCTTCG
TCCGCGTCGTATAGGAAACAAAAAAGTGTAAAAAGTAAAAATCGGTATATTACGCAATCC
ATTCGTTACCCGGTGTAGTCACGTGCGGGTGCGGAGGGCAGCCGTTTAAACCCGTTTGGG
CCTTGGTCCGATAGAACCATCTCGCAGGAAAGAGCAGAGCCAGTTATCGGGTGTCGTTTA
CGCCCAGATGTCGTTTAGCCAGCTCCGCAACGGCCACTGCCACTACCACTGCCTCCCTTC
GTATACGGAACACAGAGATCGTATACGGTAAACGACTAGCACTAGGACAATAGCAACTAA
CAATGACCGATAACAGTCAGCAACCTCAAGGCACCTGGCACAAAACCGTCGAGGAAGAGG
CCCTTTGCCACCGTATCGCATCGCTTTCCCACCAATTTTTTTTTTCTTGCTTGCCTCGCC
TCTGCTGTGGTCGTATTATTATTATTCATTCTCTGCGCAGTTTAAACTATATACACACGA
TTAATCCGTTATGCATGTACATTTTCTTGTATGCGTACGCCTGTGTATGCATACTTCTAT
ATAATATATAATACAGGAGGATCTATTCTTTTTTTTCTTCTTCTCTTCTTCTCTCCCTTT
TTTCTCTCTCTTCGTTTCTTTCCTTCCAGTAAATCTTTATATTAGTTGTAACTTTTTCTC
TTTAGATAGTAGCATAGAGGACTAAGGAAAAGTAGTACAGCCATAAAAAAAAGAGGAAAA
GATGTCTGCCGTTTTCAACAACGCTACCCTTTCAGGTCTAGTCCAAGCAAGCACCTACTC
ACAAACTTTGCAAAATGTCGCCCATTACCAACCTCAATTGAATTTCATGGAGAAATACTG
GGCCGCATGGTACA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved