Saccharomyces_cerevisiae Locus Poly:3:snR78
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Poly:3:snR78
Saccharomyces_cerevisiae
Poly:3:snR78
XIII
snR78, snR77, snR76, snR75, snR74, snR73, snR72
1001..1087, 1229..1316, 1448..1556, 1641..1729, 1861..1948, 2030..2135, 2277..2374
3374
CATCTATATGAATTTAATACCGAAAGGATCAAAATAGTATTTATCACCGTAGATGATGT
ATCGAACAACAACGAAACCATAAACGGTAAATATAAACTGTAAATGGTATCGAACTTGGG
TAGGCTTTTGTAACCATGTTGCCAATATTTTGTGAATATCAGACCAACCATTATCAAACA
CACCACAAAGACATTTACAAAGATTTGTTTATAAGATATATCAGCGGTAACAATGGACCA
CGGCTGAAGCCTTTCAACACAGTAAAAAAAAGTGCCCAACAATATAACAGTTTGAACAAA
ATTCGAATAAAAGCACTCAAAATCTCGAGAATTCCCGCCCACATCAAATTTACGAGTCCT
CATATTGATTTTGCAGATCTCCTCAGTTGGCATTTGGCTTCCCTCAGTTTTCTGGGTTAG
TTTAATTGTGGTAAAGGAAGCATGAGGTATTATAGCGACCATATAGGCAATGAACAGAAT
AACGACAGTTTATTGCCTCGAAAGGAGTCTGATTTACTAGCTAAATTCTAATATTTGGCT
TACTACAAACTCTATCTTTCATAGAATACGTCCTTCGATACCATTTTCACCATCTTGACT
AACAACGTGTACAACTCTTTTGAAAATTACGTGCCTGAAAACCCAACCATTGCGGACAGC
CCTCAATAACGTATCTTAGCATTACCCGCACACCCATACATCTAGAACTTTTTTCATTTC
TGAAAATTTTTTTTTCTTCTAGGATTACTTCGGGTATAAATAAGAGACGCAGAAATGGTT
ATTGGCAATTAATGCTTCCTCTCTTTAATAAGTTACAATATTAGAATCCTATGATTTCCA
TCACAAAGATCAATACAAAAGAAATATTCAGATGAGTGGGAGCTATGAAAGGCTGAGAGA
GAAATTGAATCCATAAAACGTTTTTTTCCGTGTTCTTTTTTTCTTCTTTATCAAAGTTAG
TTTTTCAGATATGTCTTTTGTCATTATCACAGGCTAATTATTCCCTTGATGACCAAAATA
AATTTTTACAAACTAGAGTTTCTGAATCTTTTGTGATTAGAACGTTTATTCTTATTTCTG
AGGTTTTTAATTAGCAATAAAGAAGAAAAAACTGAAAGGAAAAGTCTAAATAGAAATACA
GTAGTATTTCTTCAATTTCTCTGCTCTCCTTTCATTTACCACACCCATTTCAATTTTCTT
TTTATTCCATATTTATTCAAAGGTGTTTGTTCATATGATGATTATAACAAAAACAAAAGC
TGGAATTACTGGCTGAACGAGTATATGTTGATACGTTTTTGCACTATCCTGACCTAGCAA
ACACCTTTAAAATAAATACTAGAAAGTTGACACATTTCCATAAATTGGAAGAATACATTT
AAGCTTAGAAAACAGTAGTTTTTTAGTGCTATTCTTCCGTAGATTGATGTTTTCGATCTA
TTTGATACAATGGAAATGAGGATCCACAGCACTGGGCACTGAGGGGGAAACAAATATCCT
TTCAAATGAGTGACAATGCTTTAGCGGGCCTAGAAAACCCGCGCAACTGATCCATTGTAA
GTTTTTCTGAGGGCTAACAGAATTTTCTATAGGGAAGAATGGATTTTTTTCTCATTTTCG
TATAATTATGTGAATTGGTTTTTATGATGAGATATTTATAGATGACGAGTCTGATCATTC
GTGAAGACACAACTATTAAAATTACCATTCATGCCTTTCTGAAGCTGTTTACATTATTCT
TTTCGATTAGCAAAGAATTTGGAAATAGAAAAAAATCGACAGATAACTAGTTCATCAGTT
GATGTGTCTGTATTGCTTCCATGTTTTTTAAAGAAAATTTCTACCTTAGAGACGTCAATG
CTGCAGAAGATGAAACAAATTACTCAAATAGACAAGCATATGTCTGATCTTCATGATTGA
AAAGAGCAATTAGTGTCTGATGCAATTTAAACTAGAAAATTTATCTGAGAGAGATGAGAG
ATCGTACAAACTGTTTCAAGGTTTTTAACTTTTCTCCAATTTCAAAAATTGTTTATGATG
ATTTCCACATTTCACGACGGTCAACTGCGTTTTTCGAATGTTTATCGATTAACTTTGATG
ATATTTCGCCTGTGACAGGGCGTGGTACTGAGCTTTAATATTTTTAGCAAATTTAGAAAT
TGGGTCAAGCGAACCATTGTAATGCTGACTATTTGGACGACTCTAATCTCTTCAATATAT
TTGAGTTCAAATATATTAACTTGAGTAAATTTTCTCTTGCGTTAATTATAACTAATTGTG
ATGTGATGACAACTTCTTGAGCTATATATTTTCTTGAGAACATCAATGAAGAAAACGTCT
CATCAAATGATTTGCACGTCAGTCTGATCACAAGCCATATAAAATTCTTTAAGTATTTTA
TCCATTCTACCTTTTTCATCTGTTAGTGATCGATTAAAGCAACACCCAGACATTACATGG
CCCATATGGCAAAAATTTTCATCTCATCTACCTCATCACTGTGTGCATTTAGTGTATGAA
TGACTACTTTAAGCAATTTAACCAGTATATACGTATAAAGAGGTCAAGTGTACGGATAAC
CCAAAGGAAACATGCCTTCCGAATCATCCGTCTCTATCTACAAGCTTGATCAGTTGGAGT
ATCAGTACCATTATTTGACAAAATCATTACAGAAGTTTGAACCAAGATATCCAAAAACTG
CCAAATTATACAATTGTATAGGTAAAAAGAACAAAAAGAAAATTGAAAAACTGTTAAACT
CTTTAGAGTTGAAAACTTTGGACAAAGAACTAGATGAAAGTTACTCAAAGTTACTCAATA
ATAAGATTCACTATTACGAGACGCATTTATCAAAATGTATAAAAGAACAAATTCAGAAAA
TATCCAAAAAAAATTCTAGTAAAGTGAAGGATGCTCAAAAAAATAAATCACCCTCTATAG
ATATTGAAAAGATGCTTGCTACGCAGTTGTCATTAGATGATTTAGCACTCTTCATGACAA
GATTTAGGCTGATCAAAATCTTACACCAGAGGATCAAACAAAAAAGCAAAAAGATTGAAG
GTGATACGAATAATAAAACTTGGTTGAATAACAATGATTATAGTGGTTATATCAATGATA
AGACAAGTAAGTGGAACCCAAGCAATATATGGAATGAAGTTATTACGAAGCTGCCAAGTT
GTGAAAAGTTAAACGCACTAATTGGTCAAAGTAAAATCGTTCAAAATCTAACCGAATCAT
TCGATTTGAGTATTTGTCTCATATTTGGATTTGATGTAAGCGCTATGAAAGCAAAGAAGT
ATGGAGCAAGGGAGAAGACGGCCAATGCTAATCAGACGCACTCCAACATTGACTATGACA
CCGATGACGGCAATG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved