Saccharomyces_cerevisiae Locus Mono:36:snR49
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:36:snR49
Saccharomyces_cerevisiae
Mono:36:snR49
XIV
snR49
1001..1165
2165
GTTCTGATGGCGCTCTTTACCACATTTGGATGGAAGGTGTATGGAATCAAAGAGATGAC
AACATCGTTATCAGCCAGAACTTTGTCTAAGGCACTGTCATCGGTAACATCCAATGAAAT
AGCCTTGGATCCAGAGGGCTTGGCCAATGCTTGCGCATTGGCTAATGTTCTACATGCGAC
AGTGACATTGATGTCATCATTAGCAGCCAATGTGTCGATAACAGGTTGTGCAACAAAACC
AGATCCTAGCAACAAAACGTTCTTTCCCATATTAAAATATATAATACGTTAATATAACTC
AATTGTCCTGATAAGTTTTCCCTACTGCCTAAGGATCCTTCCCATGTAATTTTACCAGGA
CCCTACGGTTTATATACCATTAAGCCAAATTCTGTGCTACTTTCTATCATCTATTGCTGA
TAATTCCATTGGAAATTCTCAATACCCTTTATTGACATCTTTATTTTTCACTACAAAGCG
AATTTTTCCAACGGAATTTCGATTCCAGAGTATGAGTAATTCTTTTCACTACTAAACGCA
TTGCTTCGTGGTCAGTAGTAACCGCAATCACACTCTTCACTTCTGTTGTGGTGAATATCA
AAAGAAACAAGAGATCATCCACAATTTCCTCAGCTTGACTTGTCTGCAGTTGCGATTAAA
ATTTGACTTTTGCTCCACCGCTCTCTACAGGTATTATATTTGGAAATCATCAAATGATGG
GAATCCCCTACGTGGCACTTAGATACGATACATAAGACTCTTGCATATGTAGCTACCAAC
GTGGGAAAACCTTTCAAGTAACAGTTTGTTTGCTCTTAGCAACTTCTAGCCCTAATGAAA
AAAAATGAAAAATAATTGCCAGCTTTTCCCCGCGACTTTTCAAAATCGGTATAAAAGCAA
GTCGAAAATCAGTCAAAAAACTTTTCTCTCTTGATTGCTTATTGCAATCTCACTTGTTTT
TTCCTTGATTTTACTTTCAATTTAGTTTACAATATCATGGGACTTTATCTCCATGACTAT
GCCATTTCTAGGTAGCCTATGGTAAACGAATCCCGTAGATTATTCACACGTTTGTTGTCT
TTGTTGACAACAACACAGAGTAAGAAAAAGCAAAAGATTTATCTCTTTTGTCCATCTTTT
TTTTATTTTGAAGGCGTGTAACATTTATTGGTTACAACATGGCTTGTTTTCTTGTCCCTA
ACAATCGCCAGGAGAATTTTTTTTGAAAATTTTCTTCTATTTTAATTATGTACATAAATG
TCGTCAGTTAACTACAAATGAGCTATCTATCAATATGCTTTTTTTTTTTTTTAATTACTG
CTCAAGCTTGCTATCCCCTTCTACCTCCGTTTCCTAGCACAGAAGAAAGTGCCCATATAT
CATTATATTCAATTTTTAACTTGTCTCTTTTTCTTTTCTGCCTCGGTTTCGCGCATCTAC
TCTACGCTATATTTTCATAATCATCTCATTTAAATGGCATTCATTCCCTTCCGCGCCAGT
ATATTAGTTACTAATCATACAGTTTCTTGTTTCAATTTTTTAGATTTTAATTAGCGGTTT
TTTTTTGGTTTTTCTTAAGATTGGTTTTATGATTTTTTTTTTTCTTTTTCAAATTTTTTT
ATTATTTTTTCAATTTTTCTTTTTAAAAGGCTTGTGGTTGACTAGTCCTTTCTTTTTAGG
GGTTGCTTTCTATGAGAACGTGTTCCATTAGTAAATATGCCAGGAGGATTATTGCTCGTG
GGCTTCTTTACTGTTTTTCTTTCTAAGCATACTTCAATACCATCAATTGACTTTTTCTTC
TTCTCTAAAGCATCGATTTGGCTCTTTTGAGTTTCAAAGTCGACGACGGCAAAATTGTCT
GCAGCTGTTATCCTCATAACTTTACCGAATTCTTTTTCTAAGGCACTTCTCAATTTTTCT
TCTCTTAAGCCATTTGTACCTCTAATGTAGATTGGATAAAAGCCGTCCTTGTTAACGGTG
CTGAATACTGGTTTTTTCTTATTTTTGCTGTTAGCACTAGCGTTGTCCCTCCGATTCCCC
ATTTCAAATTTTCTTTCAGTCGGTTTCTTGGGTAGTGTTTCAGGTCTGATGTATTCAACC
GTGGTATTATTTTTGCTAATTCTGTCGGAGTTTTCATTCATCAACTTTGAGGCCCATGTC
ATCTTT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved