Saccharomyces_cerevisiae Locus Mono:40:snR36
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:40:snR36
Saccharomyces_cerevisiae
Mono:40:snR36
XV
snR36
1001..1182
2182
GGTTATTACATCAATGCTCAATGTGCAATTATTATGTTCGATGTCACATCCAGAATCAC
TTACAAGAACGTCCCTAATTGGCATAGAGACTTAGTCCGTGTGTGTGAAAATATTCCCAT
AGTGCTATGTGGCAATAAAGTCGATGTCAAAGAGAGAAAGGTCAAGGCCAAGACTATCAC
TTTCCATAGAAAAAAGAACTTACAATATTATGACATTTCTGCAAAATCCAATTATAATTT
TGAAAAGCCTTTCTTGTGGTTGGCTAGAAAACTTGCCGGTAACCCACAATTGGAGTTTGT
TGCGTCTCCTGCATTGGCCCCACCTGAGGTGCAAGTTGACGAGCAACTAATGCACCAATA
CCAGCAAGAAATGGACCAAGCCACTGCTTTACCATTACCTGATGAAGACGATGCTGATTT
ATAAAAACATGAAAATTTATATACGAAAATATTCTGCTTCTTCTCACATCAATCTAAAAA
TTTTTTTTTGAAATTTCTTTTATTTTTAATATATAGTTCTGAAAGTCTATTTTTAAAGAA
TTAGTTCTTCTCTGTTTAATTGCCACATTGTAATTTTTTTTTGGTATGTTGAAGTTTAAC
CTGTACATTTCTTTTCTTTTAAATTGAATCAAAGACCAATAAACGGGATCCGATCACAAT
ATGATCGTCCAATAACGCTCCCTCTTGCACTTCACTTACTACTTTATAAACCTAATTTTT
ATTTTTTACTAGATTCCTTTTTTCTTCCTGCTGGCGCTTTTTTTTTTTTGCCCGTCCAAA
AGTTTTCAATGAAAAGTAATCCTCTTGAAAAGAGATACTTCTTTCGATTACAATAATGTT
CTTATTCATATACAAATAGAATATCAGAAGATCGGAAACGAGTTAAGATAAAATATAAGA
AGAGGAAAGTATTCCCAATTATGTTTTCATTTAATTGGTAGACGCGACAAAAAAAAGTAT
AATATATTGGGAGAGATAGTTCAGTCTCACCCACATTCTCTTTGCCCTGTGCCTCGCTCG
GTTGTTAATTGCCAATATTACGATCTTGAGCTGGATGACAAAAAAATAAAAATACATTTT
ATTTTTTTGATCAACGGGCTAAAACAATTAGACTTCTTTGAGTACGAGGATATCGCTATT
TTTATCTCACGGTATCGTATTGTAATTAGAACGTCTCATATCATATCGTATAATTCGGCC
TTTATTTCAAGAAAAAGAAGAGAAGTTATTCTTGTGCATGTTCGTAAACTGATTTATTTA
AAACTTACATATGACTTGAAAAAGTTTTTCTTTGAACCAAATTACAGGCATATTCCGCTG
ATATTAAGCGTTTTTCTCAGCAAATTCCTTGATAAAATCTACCAAGTTTTGTACAGCTTT
CACTGAAAGCGCGTTATAGATGGAGGCTCTGAACCCACCAACTGAACGATGTCCTTTCAA
ACCGGTTAAATGACGAGCAGCTGCCTCTTTTAGAAACTGGTCATCAAGGCCGTCCTTTTT
AAGGGTGAAAACGACATTCATTTTTGATCTACACTTTGGATCCACTGGAACGTTGTAAAA
ATCTGAATTTGCATCCAATGCCTCATATAATATCTTGGCCTTTTCTTCATTTTCAGCCTG
TTGCGCTTCAACACCACCCTTCTTCAAAATATGTTGGAACACGAGATCCATAACATGTAA
AGTGAAAATTGGAATTGTATTATAGGCTGAGTTGTTCTTCACCACCGTTGGATAGTCGAA
TGCAATAGGGGTGATTGGTACTCCCAATTCATGTAATGTTTCATCAGAAGCGCCAGAAAT
ATTCTTAAGGATGGATTTCTTGATAATGTATAGGGTTAAGCCTGCTAAACCAATGTTTTT
TTGGGCGCCTGCCATGATGACACCGTATTGAGAAACGTCAATCTTACGAGACAAAATGTC
GCTGGATAAGTCAGCAACAATTTCGATGTTGGGGTCGTTTACTAAACATTTTGGTAATTC
TGGCCATTCAACACCATGAACAGTTTCATTCTCACATAGGTACACGTATGAGAAAGCCTT
ACCTTTGATTTTATCTTCCCAAAGGGATTCATCCGGAATTTTACCAAATTTGCCATTGTT
ATAATCTTTAGCGTTGAAGATAACTTCAGCAGGAACGTGCAATCTCTTTGCCTCTTCAAA
AGATTTCTGAGACCAACTACCGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved