Saccharomyces_cerevisiae Locus Mono:12:snR4
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:12:snR4
Saccharomyces_cerevisiae
Mono:12:snR4
V
snR4
1001..1186
2186
GTTTCAAGCAAATTATGGTGTGTCCGGGATTGGCGGTAGTAAATTGTAAAACAATAGCT
GGTCAATAGTTGATATTCATACCGACACTATAATCCACAAAAGATGGGTGACATTGATGG
CTGAAATGGTAGAGGCAAGAAAATTTTTTAAAGCAATAAGGCATAGACGTTTCTATTAAT
CCTTTGTTTTATTCAGTATTTTCGATATTTCCTCTTTACTAACTTCAATTTACTGAATTT
GTATGTAATTTTTAGATGCCAAAAAAGAGAGCTTCCAACGGTAGAAACAAGAAGGGTAGA
GGTCACGTCAAGCCAGTGAGATGTGTTAACTGTTCCAAGTCCATTCCAAAGGATAAGGCT
ATCAAGAGAATGGCTATTAGAAACATTGTTGAAGCTGCTGCCGTCAGAGATTTGTCCGAA
GCTTCTGTCTACCCAGAATACGCCTTGCCAAAGACTTACAACAAGTTGCACTACTGTGTC
TCCTGTGCTATTCACGCCAGAATTGTTAGAGTTAGATCCAGAGAAGACAGAAAGAACAGA
GCTCCTCCACAAAGACCAAGATTTAACAGGGATAACAAAGTTTCTCCAGCAGCTGCCGCA
AAGAAAGCTTTGTAAATATGATGAGAGAATAATATAAATCAAACGCTCGCTGATTAAGGT
GTCATTTATTTTTTTTAATAGAGGCTTTGTCTTTTATAATTGTGTATTTTAATAATATGA
TTATAGTATATTTTCAAGAATAGAATTTTTGCGCATGTAACTTCGTTCATACTCAATTCA
CAGTAGGCAGCTGTATTTGTATCCGTACTACTGGCGTACGTGCGATGAATTAATCGTATC
CTACGGCACCTTGTAAGCAGTCGAGAAATTTTTTTTTCACTTTTTCCTTTTCATACCTAT
ATAAATAGAAGTGTTCTTGTCGATTTGAAGAAGGTTTATTTCGTTTCGCTGTAGTTTTTT
TGTCATTGATCTTTTCATTTTTTTATTTCAAAATCCCCATCAACTATTACAGTCGATGAG
GATAGGTTATAGTTCATGTGTAACATCTGTGTTTTAAAATAACTCTAGTTATCCGGGGCG
TTTTTCACAAAGTTTGTGTAAGATGCTTTCCTGGGTCGATGTGGATTGTGCCGTGGCCTT
TTTCACCACCTTTATAGCGGTGCTTTAACTATTAATAACTGAGGCTGTATTTTGAATTCT
TACGTAAATCTTGGAATCTATGGAGCATCCAGTCTCACCTGGGTTGGCTCTGGTAACGCA
TGACTTGGTATGAAAAAATTGTTTTAATTTGACGAGGAAATTTTGGCATCCGTGAAGTTC
AATACTTCCTTAAGTATTGGTTTTCAAAAAAAAAAATTCTAAAATTCTAAAATTCTTCTA
TTATACCAAAGTTATAACGTCTATAAATATCTATAACTGAAACCTGTTTTGTCATAATAC
CTTGTTTTAGTTGTGCTTTTTTTTGCTTTATCTGGATATTATCTAATATGTTTATCTTCG
TTTACCGAAAAAAGGAAATGGGGCAATATTATCGTTATCATTTGTAGTTGCGTCTTCTTT
CCTATTTGTTCTGTTGGCAGTCGCTGATCTATCCTCACAATGCCCTTCACTCTCCTTACG
TCCAGTATTCACTGCAGAAGGCATAAAGGCAGGATTCATGAATAGAGCAGATGTGGAATG
TGTCGTCTGAGTACTGAATCTTTTATTCATATGTTGTCTCCGTTGTTGAGATGCAGTGAA
ATCTGTAACGGAAGTCCTAGGTGAGATCTGAGTGGAAGGCGCCTGTGAGAATTTGATGGA
CGATTTCCTGAATCCCTCCGAGATCGGGGAACTTGATGCAAATTTTAAAGCTGGTCTTGT
ATTTTCTTGCTGTTTTAACGGTGTCGCGACATCAGAGTGCTGCCTACTTAGAGTAGGAGA
AGAAGATCCGCGTGCAAAAATTGGTTTTCCAGTCTCTCTCATTTCGTCATCCATTTGTGA
AATGTCTTGTAATACCTTTTTTTTTAACTTTTTCAAGACTTTGGATAATTCGATTGCTTC
CTTCGTGCGCGTCATCAAGTTACTGTCATTAACCAATACAGAAGTTCTATAAATAGACTT
CATGACATAGTCGACAGGTGGTAGTGCATTGGGTGAGACCATATTTTCCAGGCTAGATAT
ATTAACATATTCCGAACCATCTTCTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved