Saccharomyces_cerevisiae Locus Mono:38:snR81
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:38:snR81
Saccharomyces_cerevisiae
Mono:38:snR81
XV
snR81
1001..1201
2201
CAATTTGTGATCGAAGACGAAGAGGGAAGACTCACTCAACAAAAAGGCATCCAGTTCTT
TAGTCTTCTTCATGGAAAGAACTTCGCATTTCACTAATTTCAAAATCTCGATCCATCTAT
CCATGCCAATATTTCTTAATGTCTTTTCGGTCGTGATGGACTTCTTGTGAGGGAAGAACC
AGATTTCCAGCAACTTCTCGGGACCCTCGAACGCATCCGTTGAGTCTAAAGTGGCTGATA
GTTCGTGGTCAATGTAGTTGTGGTTAGTCAATTCTTTTATGGTGACAGTCATTCTATGGT
CCGCCTATTTGCGTAAGACACTATATGAAAACCTAAAAAATATAAAAAAGAAGCTACAGT
ACAGTAATTGATTAACCTGGAAGAAAAAAAAGAAAAAAAGAGTTGATGCAAGGAGCGAGC
TGTAGCGAATACAATATATACACGTATAGATATGCAGAGATGCTTTTAGTCGATTAGCAA
AGTTTATTCGATGCCTAAATACCGGAGAACCGTGTTTGGAATTTTTTTTCTTCGAGTGGA
AAAAAGTGAAAATTTCCAAAGTCAATCATTGTGTACGTACGCTGAAATTGGATGCAGAAG
AGGTAAAAGGCGAAGGAAAAGAGGGCGAGGGTAAAAAGCCTGATTGCCAAACCATGGTGC
CCAATTTATTGGATATTACTACTGATGGAAGGCTACATATCTCTGGCGCTTTCTATCAGC
TGTCATCGATTTGAAATTCTTCTAGCCCTAGGAACGCCATTATGGGGCTTATCCGGGTAG
CCAGTTGGCGGTTTTAGTTTTTTCACTTCTTGATTTTTTTCTAGTTCGAAGAATTTTTTC
CACTGATGATTGAGCTATAAAAGAGCCTGATTAAGATGAAGAGCTCCGATTCTCTTCGTT
AACGGAGCATCAAACATGACGTTAGCGTCAAGTAACCTACGATATTTGTGCAACAGACAT
GATGGAGTACCCTCATGCTTTGGCGCGTGCGCATCTATATAAGGTTAGGGACTGCAAAAG
AAGCGGCGAGGCAGCCCACATCAAGTGGAACTACACAGACTTCCTTGTCGCGATACTACG
GTCCCAAGAGCAATCCTAACAAGCAATTACATATTCCCCCGCTGAACCTGTACAGTCCAC
GGATGGTGCAGAAGTTATATGATTTGGGGGAAGACGCTTTTTCACATCTTCTTGCATGAT
AAGAGTAGTAGTAACTAAGTAATATGATTCAGTCAGTCTCTAGTTAATATAATTAGGCAT
TACCCTACATTGTGGCGGCCTCTTTTTTATTTCGAATCGGGCCTTCCTTCCACCCCGGCC
CCGGTTGCGTCGATCAGAAAATTATATTATGGATGAGGATGATGAAGGTGCTTAACCTTT
ACAGTCAAACTTTTAATAGTCAACCATTCACAAGGACTAGGAATTTGTCTCTGGAAACAG
CTGGTTCCACAAAGAAGTACTTCCACGACATTGCTATATACTTGTGCTGGTATATTTTTC
TTTGTTAGTTAAACCCCATTTTTATAAGCGTATCGTTTCGTATAGTGCCGTACTCAAAGA
TCAAGGATTAAAACGCTATTTCTTTTAAATCTGCTATGTCTGCTGCTCCTGTCCAAGACA
AAGACACTCTGTCCAATGCCGAGCGTGCGAAGAACGTCAACGGGTTGCTTCAGGTGCTCA
TGGACATTAACACTCTGAACGGAGGGAGCTCCGACACTGCTGATAAGATAAGAATTCATG
CCAAAAACTTCGAGGCAGCTTTGTTCGCAAAGAGCTCTTCAAAGAAAGAATACATGGACA
GCATGAACGAAAAAGTTGCTGTCATGCGCAACACGTACAATACGAGGAAAAACGCCGTTA
CTGCTGCTGCCGCTAATAACAACATTAAACCCGTGGAACAGCACCATATTAACAACTTGA
AAAATTCTGGCAACAGCGCCAATAATATGAATGTCAATATGAATCTAAACCCACAGATGT
TCTTGAATCAGCAGGCTCAGGCAAGGCAACAGGTTGCGCAACAATTAAGAAATCAACAAC
AACAACAACAACAGCAGCAGCAGCAACAGAGGCGTCAATTGACTCCTCAACAACAACAAT
TAGTGAACCAGATGAAAGTGGCACCTATTCCCAAACAATTACTGCAAAGAATTCCTAACA
TTCCACCCAATATCAACACCTGGCAGCAGGTCACTGCTTTGG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved