Saccharomyces_cerevisiae Locus Mono:19:snR32
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:19:snR32
Saccharomyces_cerevisiae
Mono:19:snR32
VIII
snR32
1001..1188
2188
CGTATTTTAAAACCATAATACAAGGAGAATCCATGATGTCTTGTCTGGTACCAACACGT
TTTACTTTGACCCTTAACACCGCGTGTCTTTTGACGAGCACCTGGGGGTTTGTTAGGGCC
ACATCTGTAGTCTTACCTCCAAGTTTAAGTAAAGCAGGCCATAAACAGTTTCTAACCATT
ATATCTATTATTGCAACAATCATTAATAACGCGGTTAACATTTCTAATTATTATATCCAA
AGAAACAATAAGATGAATCTAGAAACCAAGAAAAAATCAGACTTTATTAGTAGACATGTC
ACTTTGCCAGTTTCTTTAGTATTAGAATCTATTGTTGCTACCGTTTATTGGCCGCTTAGA
TTGTTTTTTGTCAACTTAATAATGCATGGAGTTGAATCTACTGCAAAGACACCTTTTCCT
ATGACAGTGGATATGGCAATCCACTTATATCCTATTTTATATTTACTAGCCGATCACTAC
TTATCGGGATCTGGCACGAAATTCAAATTATCGAATAAGCATGCATGGCTCATTGTAACC
AGTTTAGCATTTTCATATTTTCAATATTTAGCATTCCTGATAGATGCGGGGCAAGGCCAA
GCCTATCCATACCCGTTTCTAGACGTGAACGAGCCGTACAAGTCGATTATATTTGTTGTT
GTTGCTACTATTACGTGGGCTTATTATGTATTTTATCAAAAGTTTCCGCCAAAATACATC
AAGAAGTCGGCAAAGAAAGGTGATAAGAATTAGCATTACTACTAGTATACTACTATTTAA
GCTCTTTGTATGTAAAGTGAGCAAATCTCAAATTTTGCTACTTAATTCTTATTTTCGTGC
TAGCCCTACAACGGAACCCAAAAAATCAATCACCAGGGTAAGCGGGAAAAAAAAAAAGTG
TAGGAACCGCACTATAAAAAGTCGAAGGTTTGTATTAATTTTCCACACCTCTTTAGTTTT
GTTATAATCAAATTCCTTTTGGTTTTTGTTTTAAAAAGGCCAACATCATAATTATATCGC
GAATGTACTACTAGTATATGCAGTTTTCTTAAAATTGCAGGGAATGACTAAAAGCCCACG
TTTTTCCCACTTTTAGTAGTACTGAAGCGTAGATAGATTGAACGTTGCTGGGCGCCTGGT
GTTGATCATTTCTGAAATGAGATATTGGGAATCAGCTGTATCTACATTTTATTTATACAT
ATTTATTTTTACTGGTTCTTAGTAACGTACTTTAGTAGCAATGCTGTGTTTTAGTGCGAA
CGCCTACGTGTCTTGTTAACTTATCATGGTTGCCAACGCGAACGTTTACAACAGGTTCAA
AGGCAGGATGAAAAATTACGCCAAATAGGCAGGTTTTCAATATTAAAGAGTTAAGTATGC
AAAATTTACAAAAAGTTAATGGTCAAAGTATAACTATAAAAATATAATAAAACAATAAAC
AATAACAACTCTCAGAATTGCAAAGCTTGACCCTTTTGCTTCTTTTCACCACCCAATTCG
AAGTGCTTACATCTCTTCAAGGTTAATTGGGCTCTAGTCTTACATTTGACACATTCCAAT
CTCAAAACAACCTTCTTGGTAGTCTTAGCTTTCTTGTGGAAAACAGGCTTGGTTTGACCA
CCGAAACCAGATTGTTTACGGTCATAACGTCTCTTACCTTGAGCGAACAAGGAAGCCTTA
CCAGCTTTGTATTGAGTAACCTTGTGTTGAGTGTGCTTACGACAGGTCTTACCCTTACAG
TAGGTCTTTCTGGTCTTTGGGACGTTAACTGGTTCAAAATGATATCACAGCAAATTTAGC
ATGATAGTTGATTGTTAGTAATTGATCTTAAAAAAAAAGTAATTTGACTGCACATGTAAT
TAGTTGTATCTTTTTTCTGTAATGGGGAAACGGCTAAATTCACAAATATCTAATGAGTAT
TACTAATGATATCCTCAATATATTTTCTAACCAGAGTTCTTATTAAAAGGGCCAATAAAA
GTATCATTCAGGTGTTCAGTACTTTAGGAAATGATGAAAATATTTAACTAGCTCAAAAGT
AAATGAAGTTTAATAACTATTAGTTTCTTGCTTGACATGGATTTGCCCTACGATTCAGGA
TATTTTAAAAAGTTCTTTAGCATTCTAGTAGTACCTGTGTACTAATTACACTCTCACGCC
CTAATGGAGATAAATAACATGGTTTGTCT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved