Saccharomyces_cerevisiae Locus Mono:2:snR43
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:2:snR43
Saccharomyces_cerevisiae
Mono:2:snR43
III
snR43
1001..1209
2209
GAAAGAGACATCAAAGTTTCATTGGTGACGAATGAGTTTTGGTAAGTGTCAGACCTATC
CCAAATATCAGTGGGTTCATCGTCTGTGGTGGTCGTGTTGAATGAATCATTATTATAATG
CTGAATTTTTTCGTTAGTAGGCGTTTGGCAAGGGGTGATGTAGCAGTTCACATCATGCGT
TATAGTCATATCATCAGCTCCAGGCTCATCATGGAATTTTTTCATGTTAGGCTTTGATAT
ATGCGTGGGATTGGGCTTAGGCATGGGTATTGGCGCAATAGTTTGTCCTCGCATAATGTT
GACAATACTAGTGGAAGCACGTTCAAGGACCGTACGTATCGGAGCAAACCACCGTTTCCA
TTCTAGACTTATGTATACACTGGGTACCCCGCAGATTGAGTGGAACACACCCAATATAAA
TCCAAAGATGAGTCCTATGATGCTGCCAAAAGCACAAAGCACAGCAAAATATTGAAACAA
CGTCAAAACCACATAGAAGTCTAATGTGCTTGTTTGTGCAACTAAACGGCTCAGCGACGT
CCCCAGGAACAACCTCAATGGGATGTTGATAGGCAATGCCACAAGCTGAAACCCATTCCA
TACGAAAATTGATAAAGGCAGTTGCACGAGGGCACGGAAGAGAGGTGAAATCACTCCCAT
GCATAGCTGCACGCTCCAATCCACCACAAACATATTGCGGCTAGTTATATACCTGCTTTC
TCCTCCTACAGTTGCTGATGAAGCCCTAAATGGTTTCTTCTTTTAGTCGTTGCTCACCCG
GCAGCTCTTTAGTTTTTTTTATTTTTTTTTTTTTCTTTTGAGATTTCTCACTATAAAAAA
AGAAGAAATTACTTTAAATTGTTTGTCTATTCCAACATAATCATTAGCAGCACATGTCGA
GCAACAGATAAACACAGCAGCGGCACGGTGAACCACATAAGTGTATGTGCACACGCGTGT
TTTGTGCAGTGTATTACCAACTTGCGCATGCAAGGATATCACACTCCTGTTTCTGCCTCA
TGTCTTTTAAAACGCTTCCACGGGACATGGGTTCTAATTATGGAGAAGATCAAGCTTTGA
AATGGCCCGTTTACACATTTTGATACAACCGTAGACGGCGTCTCGTTTCAAAGACCGTGT
GGTTGTCTATCAGTATATACTCATTGTGTTTTTCAAAAAATCTCTGGGTTGTTTAGATGC
CACTATATTTCTATTCGTATTTATTTTTATGTATACTTATTTTGCTTATTTTTCTTATAC
TCAGGAAACGTCACTTGGCTTGATATACTCGACGCTTTATTCTGCAAATTCAGGTCTCAA
ATCTGAACGGCGTGGAGCCACCAAGGGATGGAGCTGGCAAAGGAACGTAATGGCCCACAT
CAAAAACATCATGGCCAATGTCAAAATCACTGTACTTCTCCAAACACTGTACGACAAAAC
AAAACAAACAAACTCTTGTTAGTAAAAAAGAAAGGGAAACTAGTAATATGGAGACACATC
GTAAAAAAAATGTTGCACATACGCTTGGTTGTTCTTTGGAGCCATTATCCAGAACAGCAC
GGACATGGCACTAACCACTATGAATACACCAACAACAGTATAGCTAAATTGGACGCGCAG
AGAGTTAGTAGAAGAAGAAGGAAGAAAAGGGAAGCGGAGAGAAGAGATTATGACACATAC
AAACTACTCATTACTCTTTGTTCTTTATTATTCGTTGGACCTTTGTTTCTTAAAGTATAG
ATAAAAGGTCAAAAAATGTAGTAGTCTTTTTTCACAGAGCGAGAATAAAAAGTTACGGCA
AAATTTTGTGGGCAGTTGGTATCTTAACGGCCAAGAAAAGAGAGAGAGTGAAGAGCAACG
ATGTCTGCAAACGGCAAGATCTCTGTTCCCGAGGCGGTGGTCAATTGGCTGTTCAAAGTC
ATTCAACCCATTTATAACGACGGAAGAACAACTTTCCACGATTCTTTAGCGCTGCTGGAC
AATTTTCACAGTTTAAGGCCAAGAACAAGGGTATTTACGCACTCTGACGGCACTCCACAA
CTACTGTTGTCCATATATGGTACCATTAGTACTGGTGAGGATGGTTCATCTCCTCACAGT
ATTCCTGTGATCATGTGGGTACCCAGTATGTACCCGGTAAAACCTCCCTTTATAAGTATA
AACTTGGAAAATTTCGACATGAACACCATCAGTAGTTCCTTGCCCATTCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved