Saccharomyces_cerevisiae Locus Mono:22:snR60
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:22:snR60
Saccharomyces_cerevisiae
Mono:22:snR60
X
snR60
1001..1104
2104
TTTCTCCGTAATTATCACGAGCAGAATAAAGTGGAAGATTCAGATGCTTCCAAAAAAGA
GCTATATCCGATGTGGAACTTGCACCACTGCGAAGTGGAGTCGCCTTATATCATACAGGA
TGGAACTAACCTAATATTTGAATTGACCCTTTTCCAAACATGTGTGCTGACTTTATTCAA
CGAAAGCGATCATTTGACCTTGCAAGTTATATCAGAGCAAACGAAACTGGCGTACAAAGA
CTTAGCGCTAGTCTTAAAATCCTTCTGCAATTATAAAATTCTGACAAGAGATATTGACAA
CACATACAGTATCAACGAGAGCTTCAAACCTGATATGAAAAAAGTGAAAAATGGGAAACT
ACGTGTGGTTCTACCGAGAACCGCGTCTCTCCAAAGTAGCAACACAGGCGGTGAAAGAAC
CAGTTCTGCACACCACGAAGGAAGTAATTCCCAATGGACCCAAGAATTACTAAAGGCATG
CATAACTAGATCCGTTAAGAGCGAGAGGAATGGGCTAGACTACGACCATTTATTTGAAAC
GGTAAAGCAGCAGATAAAAGGCTTTAGTGTTGGTGAGTTCAAAGACGCCTTGGCCAAGTT
GTTACGAGACAAATTCATAACTAGGGACGAATCAACAGCAACTTACAAGTACTAAGACTG
GTGCCATCTTATATATTACCTAACTACTGAGATAGTTTATAATCCGTACCAGCCCTAACT
TTTTTTCCGACAGCATTTTATTTCCTTTCGTTTTTTTCGACTTCGTCGCTTTCTCCTCCA
TATAAAAAAACATCAAGAGATAAAAACTATCTTTCTTGTCCTTGTCCACGTTCAATACAA
CAGTTACACTGCAAACGACATTAGTGCAAATGCAAACTGTAGTCAATTTGCCGTATGCCT
GACATACAACAGGTGTTGTATGAGTGTGACAAGGACACTTTATATATCTTTTTCAATCTC
TCTATCCGGCCTTCTTGGCAGGATAGCTTTTCGTTTCAATTTGTTAATGATGATAACCAA
AGATGCATAGTTCAACTGATTGAACATACTATCGAAATGAAGATAAAAATTTCCATCGAA
ATTAGTCTTTCGCTCCTATCTGAACATTACAAAAGAAACGAAAACTGTATTAGTAATATG
CTTGTAATTGGAGAAGGGCCGAGGGGCGAGACCATTGTGGAGCGATTTTAAACCTCTTGC
AGCACGAATCGTAACGGACCCAGCGCGTACTTTATTCTCCCTGTGCATTCGTGGAAGTTT
TGAAACTCTTAAAAGTGGGCTCATCTGTCTGGTATTATCTGTGCCCCTGTTCTACATGTA
CTCGTGCTTTCTTTATTGCTTCTTTCGGTAACTCATCTTGCACATGCTATTCTTTTCGGA
GTTAACGAAGCCAGGAGGAACCTTAATGGATTTACCTCTAGCGCGTCAACCCTAGAAGAG
GGACTTTTTCCACATGAATAGTCAACTTTTAAGATTCGTTAGTAGTTGTATAGGGACATA
TATATGCACATATATATAATTATATACTTATACACTTGCTTACAGGGGACATTTTTGACC
CTCAAAGGAAGTGAATTACAGGTATTGAATAACAGAAATGTACGAGATGTCAGGTATAGA
CAGCCTCTTTCATGATCGAGTTGTTCATGATTACTCTCATACTAGTGAGCAGGTTATCGT
CGTTTACATTAGTTCAGCAGCCGGGGACAATTCTTGGCTTCATCAGTGGTTCAAACCAGG
AAATCTTAGTGACGAGGAGCGCGAAAACATACTGTGGGTAAGGTTAGTAAATGGTACTAA
AGAGTGCTTGCTTTTCAAGAGCATTTTCCCCTCCTCATCGGCGCCAAGCATTAACATATT
ACAGAACGGTCTACTCGAATGTTCTATCCAAGGTAATAGCCTTTCTCGTGAGCAGGATCC
TTGGGAAACCTTTATCAATGGGTTACAATCAGTCTTTAAGGGTCAAGTAACAAAGAGGAA
GTTATTTTCCAAGAGCAATGAAGAATATCAAAGAGTCAAAAGAATGATTCAGAACGACAA
GTTGGAGAGGAAGTATGTTTTTCAAAATACTAATGACCCGCAAAGAAAGCCACAGAAGTG
GAAGC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved