Saccharomyces_cerevisiae Locus Mono:29:snR79
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:29:snR79
Saccharomyces_cerevisiae
Mono:29:snR79
XII
snR79
1001..1084
2084
ATCTATTGTCAAATTCGGTGAAAATATTAAAGAAGTTCACTCATTTGACCAACAATTTA
GTAACGAATCTGGCGCAAGAGCTTTTCAATGGTTTGGTTTCCAAGAAACTAAAACAGACG
TTAAGAAACTTGTGGCTGAATCTACTAAAATTTTTGAACGTGCTCGCGCTATGGTACATA
ATGACCAATGGCAACTAGAAATTGTAATCTCTGATGGTATTTGCGAAGACCATGAAACAA
TACAAAAACTGGTCCGCCGTGCTAGAGAAAACAAAATTATGCTGGTTTTTGTCATCATAG
ATGGTATTACTTCTAATGAATCCATCTTAGACATGAGCCAAGTGAACTACATTCCAGATC
AGTATGGCAATCCGCAATTAAAGATTACCAAATACTTGGACACATTTCCTTTTGAATTTT
ATGTTGTTGTACACGATATAAGCGAACTACCCGAAATGCTTTCACTGATTTTGCGTCAAT
ACTTTACAGACCTGGCATCCAGCTAAGTATATCGTGAAAACCAAGAAGAGGAGGTTTACT
ACACGAATCAAAGGAACAAAAAAATCATGGAACTGAAAAAAAAAAAAAAAAACTACTGTA
AAAAACTACTGTAAACTATAAATTATTAATTAGACTGAACGTATACCTATATAAACCTGA
TATAAAAATGATTCAAGTTATTAGTCCTTTGCATTTTCTGTTAGCAATCCTTTGTCAATT
AGCCCTAAGAAATATTATTCCCATATGGGTAACCAACTCTCTTTTTTTTTTTTTTTGAAG
GGATCAATACTTCAGTCAGATATTTAAAGAGAAAAATTTTCTTCAAGATGCAAGTTTCCC
ATTCAGTTCTATAGGAAGTTAAAACAAAAGAGCTGTTTGAGAGCTCGTAGGCTTTGGTTG
TTAAGAGAACGGACTAAATAACACCAGGAGGTGTGTCTAGACTTAGTTGAACGAGTTTTT
TCTCGTGCTATTATATCTGTTCTTAATACTTCCACTTTATTTTAATGATGATAGCATGAT
TTATGTTGCTCGAAGTTAATCGATGTGAGCACAATGATTTCTCAAGACTACAACGGTATC
TGAATTTTATTTCTTGTCAAAAATGTTTTATAGAAGCCACTCTTGCTATAGATTTATATT
GCCACACATAACTTTTTCACGTAAATTTGAAAGAGCTATATTAGCTGGTGCTTTCACTAA
CATCTCTTTGCTCTAGTATTTCATTTCGGTGCATAAAACATTTGAACTTCCATCGAAATT
CAATATGCTAAAACGTTTCATTGTAACACGACGCTGAAAAGACAATAAGTACGAAGGACT
CAAGAAGGAGCATGTCTAAAGGGAGGGTCAATCAGAAGCGTTACAAGTATCCTCTTCCAA
TTCACCCCGTAGATGACCTTCCAGAGTTAATCCTTCATAATCCGTTATCTTGGCTATATT
GGGCATACCGCTATTACAAGAGTACGAACGCACTGAACGATAAAGTACATGTAGATTTTA
TAGGAGATACCACTCTTCACATCACGGTTCAAGATGACAAGCAAATGCTATATCTTTGGA
ATAATGGATTTTTTGGCACTGGTCAATTTAGCAGGAGTGAGCCTACATGGAAAGCTAGAA
CAGAGGCCAGACTGGGTCTCAATGATACTCCCCTCCACAATCGGGGAGGAACAAAGAGTA
ATACTGAAACGGAGATGACTTTAGAGAAGGTCACACAACAGAGGAGATTACAAAGATTAG
AGTTCAAGAAAGAACGTGCGAAGTTAGAAAGAGAATTACTAGAATTAAGAAAAAAAGGTG
GTCATATCGATGAGGAAAACATCCTCCTTGAGAAACAACGAGAATCATTAAGAAAATTTA
AACTAAAACAAACAGAAGACGTGGGCATCGTTGCACAACAGCAAGACATTTCCGAATCAA
ATTTAAGAGATGAAGACAACAATCTTCTTGATGAGAACGGTGATCTTTTGCCACTAGAGT
CACTAGAACTAATGCCAGTGGAAGCTATGTTTTTAACTTTTGCACTTCCTGTTCTTGACA
TATCTCCCGCGTGCCTGGCAGGGAAACTGTTTCAATTCGATGCCA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved