Saccharomyces_cerevisiae Locus Mono:9:snR84
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:9:snR84
Saccharomyces_cerevisiae
Mono:9:snR84
IV
snR84
1001..1550
2550
GGTAAACGGTGTACAGCCATTATGAATGCGCAATCAAGCAGGCACTGTAGTGTAACAGG
TACGACATCATGGAGTGAATGGTAAAGGGGAAGAACTTTATATGAAAAGATATATCGATG
TCAGACGAATTTGGTTATAAGAGAATGTGCATATTTTCCTTTTTAACTTGCAAAAACATT
TTCATCTATCAATACCCAACCTTTACCTAATTTCTTTGATTTTATTTCCTTAGGACTGCT
TCTCTATGATTACACCTATTATGGATAGTACTTGCACATGTTGTAGTCGTGGAGGATGTA
TTATTTCCTGAATTTACCTGCAAGAACAGTACAGACAGGGGAGGGGCGACTAGGTTATAT
AAATAAAGTAATCACAAGATGCTAACCAAAGTGTTTCAGTAAAAATATGTATTGTTAAGA
GTTCTCATGCACATCTTTGAATTCTTATGATTGTGTTTTATTATTTGACTTGAGAGCATT
TTCAACCATGTTGAACGTTAGAGGAAAAGAAAGCCAGAATAAAAAAGCCACCAAGAAAAT
GTACATGTTTGGGCCGAGGCGAAAAATTCTGGAAGTATAACATTTGATAGACTATATAAT
GACTAGATATTACTGCTCAGATGGGCGATCTGCATGTTATCACACATGGTGCTTGTGCGG
AAAAATAGTAAATGCTTGCGTCAATAAGTTTGACAATCTCCGAGTGCATAAATGTTACCC
TGACATATGATCTGAAATTTTGACGTGACATGAGAGGACCACGAAATCCATAGAGGTTAG
TACAAAAGAATCCAGCCGGGTATCCTAACTAGGTGAAAAGTGAAAAATTTTTCATAACTA
ATAAAAAAAGATGCGATGAGAACGACGATGTAACTACAATCAAGCTACTTACAAACGAAG
AGAGCAGTCAAGTATCCGAAGTTTAAAGTTTGAATAACAGAGCTAGTTAATGAGAGTACT
CATCATCACACTATAAGCTTTATATGGATATGCTGATGTGAATTGCACAACTTAAGTTTG
TCGAGGATCATTTTTTTGAACTGAATCATGCTCTTTTTAAGTGCTTTGAAACCCTCGATG
AATGTGTCAATGTGCAAAGATAAACCATTGTTCTCTGTTGATCAGTGACTTAATGTTTGC
TTTGGAGAATGATATTTTCCCTTTCCTATATTTGACTTTTGTTCTAAAAGTTATTTGGAG
AGAAAAGGCATGATTGAGGTTGCGACTTTTTCGTTTTTGCTTTTGCATGGATAATTCATC
CATGCACATCTCACTTTATTGGACCTTCAAGATTGGTTTCCCATGTAATTTAATTTTCTC
TCCTCTACATTTAATATGTTCTATATTAATTAATACCAATTGAGTTGTGCGTACTTCATT
GCAGATATTTTACCAGACCTGTCTGAGTTTTTCGTTCAAGTTTGGTTGAAATCGGCTTGA
GGTATATGAACGTGGTTGGGATATGGAGATTGGGAGATCAAAGAAGCGAAAATACCTGAG
ACAGTTTTTTTAAAAAAGAAGCTAAGGAACATGACTCAAAGAGACACATTATTCTTGTTT
TTATGAATAGGCGCTGGTCGGCGCACCTGTATGTACTATTATTTTTTTCTCTATCTATTT
CTTGGTTCGGAAGTCCCCACCGCCTTGTTTCCATAACCAAAGTGCATCAATAGCATAATT
TCTGACTGACAAATTTCTAGTGAATTTCTCATCAGAGGAGATTTCTAAGGATTCGATGAC
TTTTCCGTCTTTAATCAAGTCCCAAAACATGGAATAGATCTTATCCATAACGTTCGATAT
GCTTCCGTCTTCCTTGTATGTGTCTGCATCTATTTCTGGCACTAGCTGGTAGTAGCTTTT
TTGGCCTAGCTTATAAAGTATTCTCCCCAAAGTTTGTATAGCAATGCACCTTTGAGAAGG
AAAAGTGGATCTTGCTAAATGTTCTAACTCCACTATGGTGTAACCGGCGAGTTCAGGCGA
GTCGCTGTGATGGTGCAACCCTGAGTGAATGGTAGAGTCTATTTGTCTTGTGGGTGGAAC
AAGGTCGCCATTAAAGTCAAACCTACATTCAGATACGTCTTCAATGATGTAATTCTTGTC
TGTTTTTTGCTGAACCGGTTGCATCCATTTTAATTTGTCGACCTCTTTGGGCAAATCAGG
GAAGTATTTTTCGTGTAATTTATCGTTGAAATTAGGATCATTTATATCAAGTTTCTCTAA
ATTGATTTCATTTTGGCTCTCCTCTTTGATAAAATGAACGTCTTTGAATAGCTCTTCATT
TTTCATATGATCAATGCATTGTGCCATCTGGAAATCTAAGGGTGCGATATCATCGACGTC
ATCATTAGTTTTTCCTTCTCCTTCCACGTCTTTTTCTTTTCCTGCTTCTTCAAATTGAAC
ATGTTTTGCATCTTTGCCTAACATAGGCCTAATTTCTAAGGCAACGTCTACATCTTCATC
GTCTAACGGTGGTAGATCGTATATGCCTTGCTTGTTGCCACCTACCCAGGTACCAGAAGC
GCCTTCTATTTCTGCAAATAATGGAGTGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved