Saccharomyces_cerevisiae Locus Mono:31:snR85
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:31:snR85
Saccharomyces_cerevisiae
Mono:31:snR85
XIII
snR85
1001..1171
2171
TCCATATACATGCAGAGACCGGTCCGCAGACTGTGAGAGAATAAACTGATTTAATGGGT
CCCATGCAACACCTTGGACGTAGTGACCATGATCCGACTGGCCGCATACCAGCATCCCAG
CTCCAACATCGAACAGTCGTATCGAATTGTCCATACATGCCACCACTATGTTCCTGTTAT
CAGGTGACCACGCTAGATCGTAAATCTCTGCCGCCGCAGTAGCACCGCTACCACCACGCA
GCCGTTTCCACACAACCCATTTCTCCTTGTTCTCGTCTGCTTCACTAGTCTCCGCATCCA
TTCCGAATGGTCTGACCACAGATTCTTGCTGTGTATTTGGATCTTCTTGCTTCCATAGCA
GCACTTGGCCGTCATCGCCCGCAGACGCCAGTACGTCACCCTTCGAGTTGAATCGGATTA
CATTTATGGCCTGTTCGTGATGCGTCAGCGAGCCAAGAAAGTCAAGGCTTTCAATCTTAC
GCACCCCCCCATTTTGTCCGTTTTCATCTCTGTTCAACTTCCATATCCTAACCTTGTTAT
CACCACCAGCGGTGAAAAGCTTGTCGTTCGCACTGTTCTTTTGGAATGTGAGCGAGTAAA
CGGGTTGTGAATCATGCCAGTAGATTTGCAAATGTGAAGCTTCCATTGTCCTGCCCCTTT
GCTCTAAGCTTTTCTGCCTCCTTCTTTTAAATTCTGATACGTACTATAACGCTATAATAA
TAGCCCATCAGTTAGACAGCGAGTTAACTAACGTGTTCGCCGGGCAACCCAAGGAAATAA
GGCGTCCTTTTCACATTTTCATATTTTTTCAAATTTTTTTCAATTCTAATTTTCCTTTTT
CTCCCCCACCGTCTATAAAAGCTAGTAGTTTTCTACTTTTCACCACAGAAATCTATTCCT
TCGATAACAGTCCCTAAATAAAAACACGACAAAAAGGCCCCACGCAAGCATGTGCAGCAA
CGGACAGGCGTCGTGCGCACAAACTTGCTCAGGGGCCCGAATACTAGCACATATGTCAAA
TTCCTAATTAACGTTTTTTATATTCATCGTTTCTTAGAGCCGTAATTGTGCTGATATCAA
TATCAGGGAAGAACATACCATATAGAGGTGTCAAGTACACCGAACGATCGTGGTGCTCCC
TCAGCCACGGGCGTGCTTGGACGCTATTCCCACATATATACGCAAACAATCTATGTCTTC
TCCCTCCTTGCCAGAAAGCCGGCTCCTGCTTGTAGTTAAGGTATATATGTATATATTCCG
GGTAAGAATATTTTGTAATACCAAAAATTTTCTTCTTGAAATGAATACTTTGAGACATCT
TTAATATTCGAACAGAAACACAAATAAAGAGATAACCCTTTCCACCGCTAAAAAAAGGAC
CCCATCAGCCATGGCTACACCTTCATTTGGCAATTCCTCTCCACAATTGACCTTCACTCA
TGTTGCTAATTTTATGAACGATGCTGCTGCTGATGTATCCGCTGTGGATGCCAAGCAATT
GGCCCAAATAAGACAGTTTTTGAAAGCTAACAAGACAAATCTTATCGAGAGTCTGAACAC
AATAAGGCAGAATGTAACTTCTTCCGGCGATCATAACAAGTTACGCTCTACAATTGCAAA
CTTATTGCAAATAAACGTCGATAATGATCCATTCTTTGCTCAATCTGAGGACCTTTCTCA
TGCTGTAGAATTCTTTATGTCTGAGAGATCATCTAGACTTCATATAGTATACTCACTTCT
CGTTAACCCTGACATCGACCTCGAGACATATTCATTTATTGACAACGATAGATTCAATGT
AGTGGGGAAATTGATTTCTATAATATCATCTGTAATCCAGAACTACGACATTATTACAGC
TTCATCTTTAGCACATGATTATAATAACGATCAAGACATGTTCACAATTGTCTCATTGGT
GCAGTTAAAAAAATTTTCTGATTTGAAGTTTATCTTGCAGATATTACAAATTTTGAATTT
AATGATCCTCAACACAAAAGTACCAGTAGATATCGTCAATCAATGGTTTCTACAGTATCA
AAATCAATTTGTTGAATTTTGCAGAAATATAAATTCAACAGACAAGAGTATAGATACCTC
GTCACTACAATTGTACAAGTTTCAGAATTTCCAAGACCTCAGTTACCTCTCAGAAACGCT
TATTTCCAGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved