Saccharomyces_cerevisiae Locus Mono:24:snR64
snOPY snoRNA Orthological Gene Database
Saccharomyces_cerevisiae Mono:24:snR64
Saccharomyces_cerevisiae
Mono:24:snR64
XI
snR64
1001..1101
2101
CGTGGACAATCTCACCAGCGTAGGCAACTTCACCACCAAATACGTCAAACATGCATTGC
TGGCCCATACAGATTCCAAATACAGGAATTTTCCCAGTAAAGTACCGGATACAGTCTCTT
GAAATGCCAGAATCTGTCTTTGGGTGGCCTGGTCCAGGCGAGATAAGCAATGTGTCGGGA
TTCAAGGCGGCAATTTCTGGAACTGTAATTGCATCGTTACGGTAGACGCTCACTTTGGCG
CCCTCCTGGCACAAGTACTCGTAAACGTTCCAGGTAAAGGAATCGTAGTTGTCAATTAGA
ACCACATGCTTATTGATTGGGTTTGTTGCAGCGTGCACAGACATTTTTTTCTTACTTTTA
TGGCGTTCTATGTAGAACCAAACAGATTTGGTAATGTGTTAATACTGACCAGCTCCTTGT
CGAACTTTTTGCGTACCTTAATATCTGCTATAGATTAGAATGAGTCAACGAGCCATTGAT
GATCATTCAATGATTACTACAAGAGGCATTTTCCGTCGTCAGTGATATGAATAGCACGGT
GAGGTCCAGAAGAGATAGTAGGAAGTTTAATACTGGCTCAAAGGCATACTTATATCGACA
AGCTAAGCGCAAATACTACTTTGTGGTACATCATCAGCATTGCTTTCGAGAAAACAGCAT
TTAAAATCAGCCATTTGCTGCGCTTTCTTTAAGCCCTAACAGAAAATAGTTCAAAAAGGC
CTATAAGAAGCAAAAAAAGTGAAAAATACGAAAAAATACTCCAGCGGAGGAGTATAAAAG
GGAGGAAAATACAAAATGTAGTTGTGTTGTTACGCATCTCAAAGAAGAAAGAAGAAGAAG
AAGAAGAGGACGTCGCACTTGCAAGCAAAAACAGCGACTGGCGCGAGAACAACAAACACT
AATGCATGTCTCTGTCCAGCAGGAAAAGCGAGCCTTAGTGTTTCTTATTTTCTCGTTCGC
CTCACTAGTTTGTAGTAGGGTGGGAGAAACGATGGAGTGGATTGTATGATGAGGAACCAG
ATAGGGACAACAGATTCTCAAGTGACGAGGAACATCTTTTAAAGCCCAGTTTTTAGTAGA
GCTTAGGGCGCCTTTACTGACTATCCACTCCTTGTTAAGCTATGATCTTGTATTCATGTG
ATTGTAAATAATATTAGAGCTCTTTCTTGAATTGCCATTACGCTTCCATGCGGCATATTC
TCGTGTAGTGTGACAAAAGGTGCGGGTGGCAAATAAAGGTAAAAGAAAATGATCAAAAAG
GGCCTTTAAGTAGGATGAGCAACCGCCAATCGCTGGATATAAGCAAACAAAAAGTAAGAT
TAGTAGCAAAGCAAAGAACATATAACTATAGCTATGAGCAGCAATAATAGTGGTCTCTCT
GCCGCCGGAGAAATCGATGAAAGTCTTTATTCTCGTCAACTTTATGTGTTGGGTAAGGAA
GCAATGTTGAAAATGCAAACCTCCAACGTATTAATTCTCGGCTTGAAGGGGCTAGGTGTT
GAGATAGCGAAGAACGTTGTGTTGGCAGGTGTCAAATCTATGACCGTTTTTGACCCTGAG
CCGGTTCAATTGGCAGACTTATCAACCCAATTCTTTTTGACCGAAAAGGATATTGGTCAA
AAGAGAGGAGATGTGACCAGAGCCAAATTGGCAGAGTTGAACGCATATGTCCCGGTTAAT
GTGCTGGATTCCTTAGACGATGTTACCCAATTGAGTCAATTCCAGGTCGTTGTCGCTACG
GACACTGTTTCTTTGGAAGATAAGGTGAAAATCAACGAATTTTGCCATTCCTCCGGTATT
AGATTCATTTCCTCGGAGACAAGAGGGCTGTTTGGTAACACCTTCGTAGACCTAGGTGAC
GAGTTCACAGTGTTGGACCCAACGGGTGAAGAACCTCGCACTGGTATGGTTTCAGACATC
GAGCCCGATGGAACAGTGACCATGCTAGATGATAACAGACACGGGTTGGAAGACGGAAAT
TTTGTCAGGTTCTCCGAAGTAGAAGGTCTTGATAAGTTGAATGATGGGACCCTTTTTAAA
GTTGAGGTTTTGGGGCCCTTTGCATTCAGAATTGGTTCAGTCAAAGAATATGGCGAGTAT
AA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved