Rattus_norvegicus Locus Eif3s10
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Eif3s10
Rattus_norvegicus
Eif3s10
1
SNORA19
16455..16586
32110
GAGGAGCGCTCAGCCACTTTACATCTGCAGCCCTGAACTCAAGTTAATTTCCTACCAAG
AGCCTCAGAATTCGACGCGGTTTTAAATGGCTTTCAAGCTCTAAGCATAGTAATTAATCT
ATGAACACTAAATTTGTTAGGTAGCAATAAAAGACATGGCTTGCAGTAAGCCATTTCCTC
ACCAACACGCATTTCTTGTATTTGTGACGTGAGTTGTATGTAAAAATCGATGACACTCGC
GTATTTTCAAACACTATACAAGACGGTTCTATCTGTGTTCCTGGGTCTTCTACTCAAAGG
AGGTGGCTCTGCCCCTGCTCGTCTTCTTTCAGGAATCCTTGAGACGCTAACCCTACAAGG
ATACCAAATAACTCTGTTTATTATTTGCTTGTTCCCTCCCCTTCCTTGTCAGTTAAGCGA
CTGGTGCCCTATTTCTTAGCAACGAACACCACTGGACAGCGATACCGGCTCAGCACTTCC
GTTAAGTATTTTGAACCTTTCCAGGCGATGTCTCCGCACAGCCGTTGCGACCTTAACGCG
GCCAGATTCTGCGCACGTCATTTTGGGAATGACTGTTGTAGACACTGCCTTTTTTAGTCG
CAGATCTGACCGCAGATTTTCCTTTCCCACCCTATGTCCGCTGGAGCAGTGGTGGCCGGA
GAAAACTTCTTGGGGTTCCCTCCCGCGACCCAAAGAACACAACTGTTCTCGCTGCCCGGC
ACCCATCGCCACGTCAGCTCACGCTCGCGACGCCAGCACGCCTGCGCGCAGAGAAAGGCG
GAGCATGCGCAAAGGCCTGCCTCTTACATCCGGGGCTCGGGCGGCGGCGCTGCCGCCGCG
AGGGAATCACGTGGCTCCTTCCTTTCCGTCTCTGGCCGGCTGGGCGCGGGCGACTGCTGG
CGAGGCGCGTGGAAGCTCGCGCTAGTTCCCCTCCGCCTCCTCTCCCGGTCCAGGCCACTA
GGGAGTTCGCTGACGCCGGGTGAACTGAGCGTACCGCCAAGATGCCGGCCTATTTCCAGA
GGCCGGAAAATGCCCTCAAGCGCGCCAACGGTGAGTAAGGCAGCGGGTCGCGCCGCGCAG
GGCTGGCCCGAGGCCTGGGAGTTCGAGGGCCCCCTCCTGCTGCCCGCACCCGGGCTGTGG
AGGCCAGTGGTCACGGCCGCCGCCACCCGGCCATGTCTCACACGGCCTCCCTACTCAAGC
GGGCCGCGGCGGAAAGCGCGGATCAGGAACCGTCGCTCCCGTGTGTGTCCACTGGCTGCG
GCCCAAGGCTTGCGTCGGAGGGCCACGGCCCGCGGGTCAGATCTCTCTGATCTTGCGATT
CTTAGCCACGATCGGCCTCCTGCTGGCCTTTCAGACCGTGGACTGCTTGGGAAGCCCCGC
GCTCCCTGCCGCCATCTGGGAGTGCCGGGAGGAGGAAACATGGCTCCCTCCCGGGGACAA
TGCACGCGAGAACCTCAGCTCCACCTCCCGCCGGGGTCGGGAGCCCGGCTAGTCTACCTC
CACCCCACCTCTCCGGCACGTCTGGCTCCAGATCCCACGCGGAGGCCTTCTGGGTCAGGG
TCTACTTGCCTCACTACTAGTTTGCACTTCAGGCCTCTACTCCATTAACTTGTTTCCTGT
GTGGTGTTTCCCTCCCCACGATTCGATAAGGGTCATTTCGAAAGTATTTCGAATCATTAA
AAGTTAATATTCTTTAGGGATTTAAAAATGATCCTCCCCAGACAAGCTCCAGAAAGAGTG
GTTTCCCCCAAGGTCACTTGGAAGTGTCAGGAAACTTAAGATCAAGGTCTCTCGATATCC
AGTTCGGGTTTTTTTTTTTTCCCCCTTTTTCTCTTCTGTCTTTTTTTCCTTCCACCGCAG
TGCCACTGAGTGCTATTTCTATTTCCATACGTGTGCTTAATTAAGCCTGGCACTTGCAGG
AAAGACTTGCCCGGATCTCTGATATTGTGGTGGAAAAGTCGTGTGCATATATCTGATCTG
ACCTTTAAAAACTGCTTTTTGTTTTTTAAAATAAAACCTGATAATTATGTATCTGTGTCC
CTTTTAACTCCTCCAGTCCAAACATAAACCATTTATGTTGCCGGTTTTGTGTTTGGCAAG
ATTACTAGAAGTGGAAGCCACATTTTATGAAAAGGCCATTTGAGTCAAAACTTACAAAAG
AATACTGCTGATAATTTGTCAGGAATAAAGATGTGTTGGCTGCATACTTATATTTTTTAT
TTTGTGGAGGCAATCTGGAATAGAATAATAATGCACCGTGGATAACCTAATACTGCTAGC
ACTAATTTATTATTGAAATTAGAACTGTAGCTAATTTAGGACTTTTTGATGTTTTGAAAC
TTAGAATCACGTTGTGGTGTTGAAAATGGAATTGGACAGACATACTAAGTATAGCTATTA
TATATGTTTAAGCTGTAACATTCAGCAGCAGTCATTTTCCCCATAGTAGTCTAGCTAAAG
CACTACAGTCTTTGGCCTACATACATACATAGTAACATGCTGACCCTATTTTTCTCTCCT
GTTTGGAATCTTCATGTGAACTTGGTTAATATTTCAATAACTTTTTAAAGCAGAAAGGTT
ACATAATGTGTTCTAAATTCCTTTTCACAGTTTCTAAGTTGACTTGCTTAATGATGAGTA
ATCTGGGGAAAGTATCAGCAAAGTAGGGTAGTACTTTGTGGTACAGTGTGGCTAACTTAG
GTCTTGTTGGTGCATTTTACCTAAGACCTGTAGTGACTTCTTGGTGCAGCCCCATTACAG
TTGCCAGAATATTAAGGAGTAATACCTTAGCTTCCAAGGAACTTGACAGGAGCAGATTGT
CTTATCTCACATGGTGCTGTTTATAAAACAAGTAGATGATAAAATGGGTTTTCACTCCTC
AGAAATCTGTTTACCTAAACGTTTTATCTGTAGCATTTGTAGCCCCAGGGATATTTAGAC
CTAATCTATTGCATTATTTTAATAAATAGCCCTTCAAGTCACTCTAAGCTGTAATTAGGG
GGTGGGAAAATGTCAAAGCCTTTTACCCTTACACTCTACAACTTCAGCCTTAAAAAGTAA
AATTGAGGGGTTGGGGATTTAGCTCAGTGGTAGAGCACTTGCCTAGCAAGCACAAGGCCC
TGGGTTCGGTCCCCAGCTCCGGAAAAAAAAGAAAAAAAAAAAAGTAAAACTGATATTATG
AAACCCCACAACTAAGTAGTAACATTATAGCTTAGATACTTAATCTGTTGCAGGAATTGG
TGAAAAATGAAGGATTGATGTGAGTCTTTTCTTTATTGGTAGATACATGGTTTCAGTCAA
ATCCTAAAGATAAATGCAGAGTGCCTATTCTAATAATACATATAATTCTGGATTTTGGTT
TATAGACACTTGAAATCTTGAAATCAACTAAGTGTTGAAATAATTCCTTCTAGCTGCAAA
AGCCTTCCCACAATATTAATTAGGTAATTTCAAGGACCTCAGTCTCAGTTGTAAGAGTAA
GGACGAGTCACAGCCATGGATCATCATGAAGAGTTTGTTCGAATTTCAGTTCGTTGTTTA
TATTTTCCCTCCCCTTACTTTTCTTAGTGGGTGGGGGATTTTAAGGAGAGTGTGTGTGTG
TGTGTGTGGGGGGGGTCCTCAGCTGCTCTGTGCCCTAAAACTCATGCTGAGGTGAAAGGC
ATGCTTCATCGCTTCATCACACCAAGCAGATGTTTTATATTCAAGTGAGCGTCTTTTTCC
TTATTTGAAACTTTAAAAGCTAGATTTCTGGGCTTGGACTTGAACCTATCATTAAGAAAA
TGACTCTTTAATTCTGTCATAAAACGTTTATTTGTTTTTGTACTTTTTTTTTTTTGAGGC
AGAGCCTTATTAGGTAGCCCAGATTGTTCTCAAATTTGATCTTATTACTTCAACCTCCTT
CAGTGCAAATGATAGAGATTTGATTCTACAACATCAAATTTCTAAGCAAGAATTTAAAAG
TGACAGGAAGAAATCACACTTGTGGGCAGAACCTGGGTTTGGTTGCCAGTACACACAGTT
GCTTAAAATCAGTTGTAACTCCAGTTGAAAGGGGATCCATCCTCTTCTGACAACCAAAGG
CTGTCAGAGTTATACATGGAAGCAAAGCTCTGATACACATAAAGTAAAAAACAAAAAATG
TATTTTTTTAGAAGTAAAGACACCTTATATCTATTTAAAAAATTACACATTGGGAAAGTG
GATTATTCTTATATTTCCAGTGTTTTGCATTTTAATTTTATCATGGGGTTAGTACTGAAC
TTAAACTTGATTTGTATTTCATATTGTAAACACTAATAGCTTAAAGTTTAAATCCTTATT
GTAAAGTTAGGGATTAGGTATAATGTCATTTTAATGTTGCCGTTACAAGTTTTCTTTTAA
TTTCTATGGTATGAGTGCTTCGCTTGCATGTATGTCTATTACTATATGCAAGTAGTGCTC
TCTTGGAGGTCAGAAGAGGGTGTCAGGAAATACCGAATCGGGATTCAGGAGTTATTGATG
TAAACTTCCATGTAGGTGCTGGGAATAGAACCCAGGTCCTTGAAGAGTAGCCAGTGTTCT
AAATTGCTAAGCTATCTAGCTGTTACAGTATTTACTGATTTTCTTTTTTTTTTTTTTTTG
TTGTTGTTGTTGTTGTAGGGACTTTTGGGTTAAATTGTTTTGAAAAATGTCTAAATAACA
TGGAAAACAACCCTTGGCACATTTCCAGGAAGAGGGTAGTACTTAAAACAGGAAGATATT
TTTGTTTCAATATAGTTGTACTTCCTTGTGTCATTTAGGATTGGTGTTAGTTTTCAGGGG
TGGCCGGGTGGCCCAAGTGAAGATGGTCTTTCCCCACATATAACATGGAGGTGTTTGTAT
TGGTTTGCATATTTGATATAAGGAGTAGGGCTAGGGTTGTGTCTTGATCTGGTACACTGG
AGACAAGCCCCTAGGTTTGGTCTCCAGCACTGGAGGAAAAACCATAGGATGAAGTCGGGA
TGTTTTGTAAAGATGTTTAATATGGTATGTTTAGTATGCTATGGTTTTTGGTTATTAGTT
TGGTATGTGATTTGATCAAGTATAAACATAGTATGTGGGAGAATTAGAGCAATATTGTTT
CACTGGAAGAACTGGGACGCACCATTCCTGAAACTAGAGTCATTAAGCCTGTAAGTTTAG
TAAGCTTCTAAATAATAAACTTTTATAGGCCTTTATGTGTATGAGTGTTTTGTCTGTGTG
TGTGTTAATGCATCATGTGTGTCTGGTGTCCACAGAGATCAGAAGAGAGAGGGTATCAGT
CCTGGGATGGTGATGAGACACAATGTGGGTGGTGGGGATAGAGCTTGGGGTTCTCTAAAA
GAGGATTAAGTGCTCTTGGCCACCTCTCTAGCCTCAATTCTGTTCATTTAAAAAAAAAAT
GGTACTGGGATTCAACCCAAGGGTACTAACATGCTTGTTTAAAGGTAGAGCTTCTCCACT
CAATTCAACTTTATTCAGGAAAAGAAAAAAAATTGTTCAAGATTATCTTTTTAGAGGGTG
GTGGTGATGATTTTATTTCGTAGTCTAGGCTGGCTAACTTGACACTCAGGTCATTTGCCT
GAGCCTACCTACTAGATAAAGGTGTGGGCCACTATCTCTGGCCCCTTTTTAAAGATTAAT
TTTATGCATACGAGTACACTTTAGTTGTCTTGAGGTGTACCAGAAGACATTGGATCCCAT
TATAGATGGTTGTAAGCTGCCATGTGGTTGCTGGGAATTGAATTCAGCTGTCAGTGCTCT
GAACCATTGTTCCATCTCTCCAGCCCCCAATATTATTCTTTAGGAGAAAAATAAACATTA
AAAAAGGGAGAGATAACAAAACTAGTGTCTTAACTCCTTTAAAAGTTTTAAATATCCAAG
TGAAAGTTTTTTGTGTTTGTGTGAAATTTAGCATTTTTTGCTTTTTTTCCCCAGCTTTCC
AGGTGCTAAGATTAGAGGCATAAACCACTACAAGTTTAAGATAACATTTTAATCTAGAGT
CTTTTCTGTTGACTAATTTGAAAAGTTGCTACATATGGCAGCTAGATTTGGAGATCTAGT
TATTTACACACAATGCTTTCAAGCTCATAAAGTCAACCGTTTTTTGTCCTGTAGTTTTTA
TTTTTTAAAACCTTAATTTAAATTTTATAGAGCAAGTTTCAGTTGCATAGAATCATTCTC
AAAGATAGCACAGTTTTCATCATATCCAGTTCCCATTAATGAACATCTACAATCTGTTAC
ATCTTTTATAACTAAGGAGTCATCAACTGAAGTTATTTATTCATTTATTTTGTTTTTTTG
TAGAGGTAGGATCTTAATTTTGTAGCCCTGGAACTCAGTAGCTCCAGCCAGCCTCCAACT
CACAGATTTGCCTGTGTTGACTGTGTTCCAGTTTCCCTATTGGGCATTAGGATCCTATCC
ATACACCACATCACATTTAGTTGTCATGTCTTCATTGTCACAGTGTCTCAGACTTTTCTA
TTTTTTTTCCTTTCATCATCACATATTTGAGAAGTACTCCTGCATTTTGTAGAATGTCCT
TTGTGTTACTGTAGCACATCCTGGGTACTTTATCAAAACCAAGAATGTATCTCTCTTATT
TCTGATGGCTTTAAAAAAAAAATCCATGATAAGGTAGCAGGATCCGTATGTGGAGAGAAC
TGACTGGCTTGTTACTGTTATCCAGAGGAGATTAATAGTGTTCCCTTGTCTGATAAGAGA
GAACAAAAAGGAAGCTATCAGATTATCTAGTATAAAAGCTACCTGTTGCATTTAGAGGTG
GAACTCTTTGATCCTGCTGTTTCTTTAAAGGCCAACTCCTAATAGTATTTGGTTAGGGAG
TATGTGTCAATCCAAAGTTTAGGAGAACACTTAAACAAACATTTATACCATTGAATCTTA
ATGAGTATTTCTCTTGATAATTGTTTTTAAAGTACTAGTTTTATTTTTCTCTCAAGTCAA
TATTTTTCTTTGTAGCCCTAGTTATCCTGAAATTCTTTTAATCTTGGTTGGCATTGAACT
AAGAGATGCATTTGCCTATGGCTCCTGAATGATGGGTTGAAGACATGTGCCACCCACCGA
CCAGCAAAGTTAATTTTAAAAATACATTTCTGGAGCTAGGTACATGGTTCAGTAGTTAAA
AATACTTGGTGCTCTTGGAGAGGACTGTAGTTCTGTTCCTAGTATACAATTAGGTAGCTG
ACACACTCCCTGTAACCCTAGTTCCAAACATTTTTGGAGCACAAAACATACACATACACA
TAAGATAAAATTAATAAGTGTTTAAAAAACTTATTGGGGTTGGGGATTTAGCTCAGTGGT
AGAGCACTTGCCTAGCAAGCACAAGGCCCTGGGTTCAGTCCCCAGCTCTGAGGGAAAAAA
AAAAAAACAAAACTTATCACACTTCGCCATGAACTTTCTCATGTCTCCATGTATAGCCCT
AGGACTCCTGAGTCTCTGTAGACCAGGTTGGTTCCAAACTTAAGGGATCTACCTTCCTCA
GCTTCTGCTTCTGCCTTTGGAGTGCCAGGATTAAAGGTGTATGTGATGCTAAGTTCAGCA
GCTCTTTTTAGCTGTTAAAGGTTTATTTTTGAGTTGTTTTCTATAGAGAGACCATGGTTT
GACCCTTCTACTCAAAAGAAAAAGTGTGTGCATACATGCTGTGTGAATTGTTGAAAGAGG
CCAGGAGAAGGCATTGTATCCCCCGGAACTGAACATTAACAGGCAGTTGAACTACTTGAG
TGAGGGAGCTAGGACTCAGATAATTGAGCCATCTTTCCCAGACCCATGAACCCTTTTCAT
TTAGTTTGTCATGACCATTACATGACTAGGGGTGGATAGACTGTCATAACTTCCAACTCT
AAACCTGTATTCAGTGTGATCCCAGTCGAAATCTTAGCAAGCTATTTTATAGATGGTTGT
AAAAGTTTTATGGAAACATAGGTATGGAAATATCTATGTTAGAGAATGGATACCAACTGG
CAAAGTAGGAGCACTTACTATCCAATTCTAACACTTTACTAAATTCCTTGAGAACGGATG
GAATGCAAGGTCCTGAAGTAAATTTAAATGTAGTCAACTGGTCTTAAAGTAGACAATCTA
TCTTCATAAAATAATATAATAAAATTTATTCAGAAATTTATTCAGCTATAGAAATGAGAT
GTAGTCATACTTGAACTTTTAGATACTATGGGAGATTCTCCCATCCATGATTTCAGTTTC
TGGAATTTTAAAATCACTGAGTTCTTCCACATATAGTATTTTCAGATCATGTTACCGTTA
TACATTGAGTGATTATAGGATTGCTATTAGAAGCCAAACATGTAAAGAAAAAAAGTTGGG
AACTAAGTCAACAAATTAAAGCAATCAGCAAAGAGGCAAGCATTTTTAAAGTTCTTTTAC
ATTAATTTGTGGAAGTGACGGGGCATGCACAAAATCTTTTGTGTGCATGTGGCAGCCAGG
GGACAATTTTTAAGAGTGGGTTCTGCTAATGTGGGTTCTAGAGATAAAACTCAGAGAATC
AGGCTTGGCAGCAAGGACCTTTACCTGTCGATTGAGTCAATTTCTTTGGTCAGTCATTTA
GATGTTTATATAATATGTACAGCTAATTTTAATTCGATTCCCCTCCCCCCCAGAATTTCT
TGAGGTTGGCAAAAAGCAGCCTGCCCTGGATGTTCTTTATGATGTTATGAAAAGTAAGAA
ACACAGAACATGGCAGAAGATACACGAGCCAATTATGCTGAAATACTTGGAACTATGTGT
GGATCTTCGTAAGAGCCACTTGGCTAAGGAAGGATTATATCAATATAAGAACATTTGTCA
GCAGGTACAGAGTTTGTTTTTGTGATTTTCAAGTGCTTGTAGTAACTTTCTGAGGAATTT
ACCTTTTAAATTAAAGTTTATATCAAGATTTGCTTTTTAAACTTTTTTTTTTTTGGTTCA
TTGGAGAAAAATAAATTCATTTTCCTTCTTGTAGGTAAACATTAAATCTTTAGAAGATGT
TGTTAGGGCATATTTGAAATTAGCAGAGGAAAAAACAGAAGCTGCTAAAGAAGAGTCCCA
ACAAATGGTGTTAGACATAGAAGATCTGGATAATATTCAGACTCCTGAGAGGTACGTGAC
TTTAAGCCCTTAGTAAATATTTTGATAGTTATCACAATGTTTTTCTGCACATGGGGCACT
GTCTCCTGCCCCCTTTGAAGTAGATAATTATCAGGGGGAAACCTGCTTATCTTTAAAGTC
TAAAGTTTATATACTTCGGGAACCATGTAAGCAATATTTAAAATTTATGCCTTGGGGTAG
GACATGTATTAAAATTTAGGTTGAGAATTGTGCTTACAGTGTATATGAAGTTATATATGG
GAAGAAATTCTGTATGTGGTCAGTGTTGGTTTGGAATTTCTGATCACAAAGTAGGAAAAC
ATCTAAAATAGTTTTCAATGCATTTTCTTTGTAGTGTTCTCTTAAGTGCAGTAAGTGGGG
AAGACACTCAGGATCGTACTGACAGATTGCTACTGACTCCCTGGGTCAAGTTCCTGTGGG
AATCATACAGGCAGTGTTTGGACCTTCTTCGAAACAATTCTAGAGTAGAGCGTCTTTACC
ATGATATCGCCCAACAAGGTAAAATGACAATTTGAAATGTAAAGGAACTGATTTGAAAAG
TTGACTTTGTTCTCTATACTATGTAAAAATGGAACTAGTTTTATTCTTAGTGTTCATCTC
TCCAGCTCTAGAGTCTTTCCTAAATTTAAATTCTATTCATTTCCTATTTGTAAATTTTAT
TTTGGGTCAGAAATGATGACCATGTCTTTTGGTTTGCTTAGGATTCAGAGTTGTGCTATA
GGTATTACATGGAGGGAGTTAATGGTGAGCTTAGTAAATCTTGTTAAAGTTGATCTTAAT
ATGTGACATATAAAACTTACAGATATTTAAGTTGACCAAAAATATCTAATTCTTGTTTGA
CAATTATGCTTACAGCTTTCAAATTCTGCCTCCAGTATACTCGCAAGGCTGAGTTCCGCA
AGCTGTGTGACAACTTGCGAATGCACTTATCCCAGATTCAGCGCCACCATAACCAAAGTA
CAGCAATCAATCTTAATAATCCAGAGAGCCAGTCCATGCATTTGGAAACCAGACTTGTTC
AGCTGGACAGTGCTATCAGCATGGAATTGTGGCAGGCAAGTTGTATCACATCGCTACTGG
TATTACTGGTTAATTTCAGGAGGTAACCTGAGAATCTAAGATTGTTTGATGGAACAAGAA
GAGCTCTAAACAGGAACTTCATATTTCAGTATTTCAATATTTCAGTTAATTGCTTGTAAA
ATCTGTGCCAAATCATGTAATAATTTCATTTTATGAAAAAAGAAAAACAATCCTCCATTA
TGACTGATAAAATCTGGTACCTTTCTATGAGCTGCTGGGGAAAACATTGCAAAGATGGAG
GCTTTTGTCTCCCCCCACCCCATTTTGTTTGGTTTTAGTATAGGGAAAGTTAGTATCTGT
TTGTGCTTATGCATGCCCTTCCATGCTGGGTACCAAGCCCAGGGGGCATGCGCAGTGTGG
ATGATTACATCCAGAGACAGCTAGGAGTTTCTTCATAATTTTGTGTTTAATCTGATAATA
CATTCTAACTTCATTGTACTTGATGAGCATTTGTTGGTGATTGGAAGTTTAAACCACACA
CACGTCCTTTTCTCTGTTTGGAAGCACATCCATCATATGATCTTCATTTTAGAGATGGCA
GTGACACTGAAAAGCTTCCTGGCCTCTTCCTCCTTGGGATAGTTTCAGAGTATTTTGTTG
ATTTATAACTTAAAGTCTTTTATGTTTAACATAAAAATCAATTGAAATGATAAGGGATTA
ATTAAAAAATGGGCCAAGTGAAAATTGGTTTAATTTTTTGCTCTTGTCCATACATAGTCT
TTTTTATAGGGACACCCATCTTAAATTACTACTTAAAAAGGACAAGCGAACATGATTATA
TTAGGAAAAATGATTAGGCTTAAGGAAATGTTGAGCTATTGCTCCATCACTCACAGATCA
CCTGGATTCTTTGTTTTTTTTTTTTAATACTAATTTATTCTCACTTATTTTATGACCACA
GTTTCCCCTCACTTTCTCTAATACCCCAATCAAATGTATTCTATTGTGTCTACTTCCTGA
TTTTTTTTCCTTTATATTGTCCCAAGTAGTAAGCTAATTAGCAAATAAGCAAATATTTTC
TTACTGTGTTATAATTATACCTTTACCTCAACTGTTTAAAGATTTCAAGATAGCATTTTT
ATAATTATTGCAATTTATCAGACATTCTAGAAATGTTGGGCTTTTTTTTTTTAATTTATT
TTTATTTATATGAGTACACCGCAGCTGTCTTCAGACACACCAGAAGAGGGCATGGGATCC
CTTTACAGATGGTTGTGAGCCACCATGTGGTTAATGCGGAATTGAACTCATGACCTCTGG
AAGAGCAGTCAGTGCTCCCAACCACTGAGACAACTCTCCAGCCTCCTTTGATGAGTCTTT
AAAATTCGTCAACTTTTTCACTTGTCAACTTCAGTCTTCTTGGAATTTCATCAAGTTGAT
CTCCTTATTTCTGCTTACTTAAGTAGTAAAATTAGAAGCAATGACTGGGGACCTAAATTA
TAGGCACGAACACTATTCAGCAGAAAATGCAATACAATGCAAAAGTAACGTGGTAAAGGA
GGTCAGGAACTTGAAGGAGAGCTGACAGGGGTACAGGGCTTTTATTTTTTTTTTTTTTGT
AATCTGTTTTTAGTTTTGTAAGAGATTTGCATCTGGCTTTTTAATAAATGATTTTGTGTA
AAATTTGTTTAAAATTAAAAATTTGCTTAATTAATTAGAAATTAATTCCCAACATATTAG
GAAGCCTTCAAAGCTGTGGAAGATATTCATGGACTATTTTCCTTGTCTAAAAAACCACCT
AAGCCTCAGTTGATGGCAAATTACTATAACAAAGTTTCAACGGTGTTTTGGAAATCTGGA
AATGCTTTGTTTCATGCATCTACACTTCATCGTCTTTATCATCTGTCTAGAGAAATGAGA
AAGAATCTTACACAAGATGAGATGCAAAGGTAAGAACATTACAGTTGGATGGTAGTGAGG
TTAAGCTAAGCAGTAGTATGGTCTAATCCCAGAGTTTCTTGGCTTCTAAACATTTTAAAT
TGACTAAATCCTGTTTGGTGTACTGTTAATGCTTGATAGGGTGTTGATCACTATTCCTAG
ACTACTCCTTAGGAGCCGAGAGCACTCCAGTTATCTCTACCAAGTGTCTCCATTGTTCTC
CTTGGAGAGTATTGAGCCATCATCTATCCTTCCTGGCCCCTGAAAAAATGCTACCAGAAA
CCTAAATGAGAAGATTATGTATTCATAGAGGTAGTGTTAGCATGTGAACCTTCTATCGAC
GTATTGGTAGATTCTATTGGATATTTAAGTAATTAGTTCCATTAAATTTTTTTCTTCCTA
ATTATAAAACATTAATATAAAACAGCTCTTGACATGTGGTAGGAGTATATTGTGGTGAAC
AGACTGTAAGTTGAAAATATGTTAAGCAATGTTACACTACCTACTGTCAACAGTGTAGTG
TACTGGGGAGTGGAGAGATTGTTTACTCTTAGGATTGATTGCATGGCTAGGAACTATAGC
TCATTCATTGATGATTGACAGTGCCTAAGTGTTAAAGAATACTACAATTTATCTCACTAG
CCTGGCAAAAGGTAAAGATAAATTTTCCTTTTTTGGGGACCATGGTAAAATAGTTTATAT
TTTGTGTTTTTGTTTTATTTTGATTTTTGCTTTTTGAAACAGGGCTTTTCTCTGTAGCTT
TGGTTGTCCTAGAACCTGCTCTGTAGATCAGGAGGCTGGTCTTCAAACTCACAGATCTAA
GTCTGCCTGCCTATGTCTCCTGAGTGCTGGGATGAAAGGTGTGCACCACTACTACCTGGC
CAAAAAATATATTTTCTTTATAACATGAATCATAAAATGGAGACTATTTGGGAGATAGCA
TGAAACATAGCCTGTAGGCTATTAAAAAAATCATAGTATAGAGTGGGTGTGGTGGCATAT
AACTCTTACAGTTAGCACATAGGAGACTTACCCAGGAGGATTAAAAGTTCAAAACTACTT
AAAAAAATTCTTGGCTGGCTTAAATTACATGGCAAGACCCCTAACCCTATCATATTTCTT
GGATGTGGAAAGACTGTTGCTGTCTTCAGACATTCCAGAAGGGAGCTTCAGATCTCCATT
ATGGATGGCTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGTAAAG
CAGTCAGTGCTCTTAACTGCTGAGCCATCTTTGCAACCTCCACTGGCTTTTTTATGTGTA
TGTTGTTTTAGTTTTATAGAAGGATAAAAAAATCAACTAAATGGCTTTTTACCCCCTCGT
CAATGGAATTAATACTGTTCTTTATACAAATGCTGTAATACTTACTGTCGAGTCATTGAG
TGTGTTATTTAGGCTTCTGGGCACTGAAACCTTAGCATTCTATAGTGTTGACTTTTGTGT
TTCAGGGAAGTGAAAATTTAGCTTTTCTCTCCCTTTCCATTCTCTGTTCTAATTGTATTT
ATTTTACTTAAAGTCTGTTTTCTTAATTTCTAAAGCTACCTTTAGTTATTTTGGTGAGAA
GTGTTTCTTTACTGCTATTGGGTCACATTTAGTGTTGATGAGATTGAGTCTACTAGGATT
CATTTCCTCAAAGTTCAGTTTTCATGATGTAATATATATAATCAGGTATACAATAAGTAA
TTAAAGAGAAGCACATTTACAATCTCAACAAATAAAACTTTGTTCACCACAGAATGTCTA
CTAGAGTCCTTTTGGCGACTCTTTCCATTCCTATTACTCCTGAGCGAACTGATATTGCAC
GACTTTTGGATATGGATGGTATTATAGTTGAGAAGCAGCGGCGCCTTGCCACATTGCTAG
GTCTTCAAGCACCACCCACACGAATTGGACTTATTAATGATATGGTTAGTATAAGTTCTG
AGTATCTCTTTGTAGAGAAGACTTTGTGGTAAGTTTTAATTCATGATTAAATGCTAGGAA
CTCAGATTCATTGTCAGGCTTCTAATGTGTGGACAAGAAACCACTGATGAATTGGATATA
TTTATTGCTCATTTGAGGCAATTGGTTAAAGCAATGGTTCATAGGGTATGCGGTTAATCA
CTTACCTAGTATCTGCATGATACTAACTGAGATCCCAGTGGACATTAAAACCCACTAACT
AGGGCTGGAGAGATGGCTCAGCGGTTAAGAGCACCTGACTGCTCTTCCAGAGGTCATGAG
CTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAAAGAGATCCAATTCTCTC
TTCTGGTGTATCTGAAGACAGCTACAGTGTACTTATATATAATAAATGAATAAATCTTTA
AAAAAAAAACCCACTAACTAGTATGCTATTCTGAAATAGGGCAAACTATTGTATAAAGTC
ATATAAAATTGAAATTATCTCCAGATCACTTAGAATACTTATGTAAATCATTTGCCATGG
TTAGGTGACAGTGGCAAGAAAAGGGCATTTAAAACAGCTGCAATTATTTTCTTGAAGATG
ATGTAAATACTGACTGAGTGTATGTAGAGCCTGATGATAGAGGGACCAAGAGGGACCAAA
ACTGTTAATGAACCTGTCACTGCCCTTCTAATGGACACTGAGCAATTCTAATTTTAGCCT
AAGAAGAACAGAGCTGTCCTTCATATTACGAGAACAGAGCTGTATATCATATTACGATTT
ATTATACTTCAAGTTTTTGGGTTTTTTTTTTTTTAATTTTGCTATTATCAGTAGAAACAA
CATGGTGGGGTATTTGGGTATTTGGTGAGTTTACAGGGAATTAAGGTCAGATAATCTAGT
TTTAATTTATAGTCACTTCAGATTGCCAGTTGGAATATTTCCGTTAGCAGTTAAACTTTT
TGCTTTTCTTACTGTAGGTCAGGTTTAATGTGCTACAATATGTTGTCCCAGAAGTGAAAG
ACCTTTACAACTGGTTGGAGGTGGAATTCAACCCACTAAAACTCTGTGAGAGAGTTACAA
AGGTAGGCTTTGGCATAGGCATTTTGGTCTTTACTATATGGCTGGCATTATTGGGCATTG
TACTTGTCTAAAGAACACATTGTTCTCCTATGTATTGAGGAAGACACATTTTTTTCATAT
CAAGAGAAAAGATAATTCTGATGTTAAGGTTTGAGAGCTAAATTAGCAGCATGTCTATTT
TAGCCACTTCTGTCAGTTACATTCAGACAAGAATTGATAAGTGTTGTTGAAAGAATTTTG
CATGTTTATATATGCTGTTTTATATATATAAAGAAGTCGAAAGAATGTGAACTGTCCTTG
CGTCTGTTGCATTTTTTTCTCAACTTAATTGATTTTATAGGTATTAAATTGGGTTAGGGA
ACAACCTGAAAAAGAACCAGAATTGCAACAATATGTGCCACAACTACAGAACAATACCAT
ACTCCGTCTTCTGCAACAGGTAAAATAAAAGCAAATGATTAATGGGGAAACTGAGATTTG
TGCTCCTGACTTTGTGTTATCATGTAGTATGTGTCTATACATACTCATTTGTATATGTGC
ACGTAAGTATATGGAGACTAGAGGTGGACATGGCTGTCTTTTCTATTATTGTCTTCTATT
TTGAGATCGTCTGTCACTGAACGCAGCTCACAAATTAGCTAGATTGACTGACGATGGGAA
TCCTCTGTCATCCATAGCCACATTCCTCTTTATTTTGATGACATGACTGAAAAAAGTTTA
GAATTAACATAAGAAGTAAGTGAAAGCTACACCAAATTCCTGCCCACCAAATTGGAAATT
CCTGCCCAATTTTATTTTAAAGCAGAATTGTTAACTTAAACCACTTCTTTCCTCCCCTAA
CTTTCTTTCAAGATGTTCTGAGTTTTCCTTGGGTTACTGGCTCCCCCGAGTCCTGAGATT
AAAGGTGTGCATCACTATTCCCAGCCCTGAGTTTTCTTTGTTAATGTAGGGCTCCCTTAT
TCCTTTAAAAATCTATTTACATGATTTTTCATGGATTGAAAGATCATAGTACACTTGCTC
AGATTATAATAATGAAAACACCTCTTTCCATTACCACTGGAGCTCCTTTTAGGGGTTTTC
TCATTAGAAATTGTACAGCATCAAACATCTAACACCTTCATGTCTTTGTATTTAAGTGAG
ATTTCTGTACTATGTGGAATTAGTCACACGGTTTATGTAATAGACTTACCAGTTATCAGT
GGATAGTCGTTTTGTTCAGACTGGTTATTAGTTAGTGTTTTCATCATGTTAGGCCATGAC
TATGGTTAAGTGATACAGTTTATTAGTGGAGTAGATGCTTTGTATTTTATTTTGTGAGGA
GTTACTAAGTTGTGTCTGCACATTTCATTGACCTGCTTTCTTTTGAATATGTGAGCAGTG
TTATTTCTTATGTGCTATACAAATAGTTGAAGGTTAATTAGCAGAGTAACTGCATATAGT
AATTCTGCCAGTCCCCTTCAGACAAAAAAAAAGTAAAATGGACATACTTGTATTAGGTAA
GTGGCAGGCCTTTATCTATGACTATGTGACCATTAGACTTTATATTTATGAAATTGGAAA
TTCAGAAATGTATAATGTAGTCATAGCATATGATTTGGAATCTGGGGTTAAAACCCTAGT
TCCAGTAGTCTATTGCTAGGCTGAATTGTATGAACTTCAGTTTTTCCCTTCTGAACAATG
GGCATAATTTCTGCTTTCTTTAGCTACCATAAAATTGCACAGAAAAAGTGTGATTAAGTA
GAAGCTGTTGTTATTAACCCTGTGTTTTTTTGTGCAGGTGGCACAGATTTATCAGAGCAT
TGAGTTTTCTCGTTTGACCTCTCTGGTTCCTTTTGTTGATGCTTTCCAACTGGAACGGGC
CATAGTAGATGCAGCTAGGCACTGTGACCTGCAGGTATGTGCTATAAGGAGGGAGCACTG
GCAAGTTAGAAGGCCTTTTGAGATCTAGAAAGACACTACACATTGTTTTTGATACAATGG
CATCTTTTAAAAACTCCATAGAGCAAACTTTTATTACTTTTCTATTTTCTTCTCAAATTC
AGTTGTAATATATCCTTTGTTACTTGTGATTTAATTTTTAAAGGTTCGTATTGACCATAC
TTCTCGGACTCTGAGTTTTGGATCAGACTTAAATTATGCAACTCGAGAAGATGCCCCAAT
TGGTCCTCATCTGCAGAGCATGCCTTCAGAACAAATAAGAAATCAACTGACAGCCATGTC
CTCGGTACTTGCAAAAGCGCTTGAAGTCATCAAGCCTGCTCATATTCTGGTATGTGTCTT
GGGGTGATATGAAGTATAAAAGTTTGAAGGACTTATCTTTCATAATATGGTTAGAGATGG
AATCTGAAGAAGGGATTTCATGATTTCCTGTTCACTGGTTGTTAAGATGTTTTCGTTAAG
CAAGCCATTGAAGTGCCTTTAAAAATATCTCATGGGTTATAGTAATAACCACGGCCGTGC
CCCAGTTGTTGAGGTGATTGGGCTGTTGATGAGCTCTGTTTATATTTTTCTTGGTTTGAC
AGGATACATTTGGTGCCAAGAACAATAATAGACTTGCAAATGGTGTCCTAGGTTGTGTCA
TTGCTAGTTAGAGACTGAAAGTGCCGCTAGTTTGTACTAGAACATTATCTAAATACATAT
ATTTGTGGAAAGACAGTGTTTCACAATTATTTTTAATATTGCTGTCTAATACCAGGGTAT
ATTTATGATCATTGTAAATGCATTGTTTTTTGAAGCAAGAGAAAGAAGAACAGCATCAGT
TGGCAGTTACTGCGTATATTAAAAATTCACGGAAAGAGCATCAGAGGATCCTGGCTCGGA
GACAGACAATTGAGGAGAGAAAAGAGCGTCTTGAGAGTCTGAATATTCAACGTGAGAAGG
AAGAACTAGAGCAGAGGGAAGCTGAACTCCAGAAAGTACGGAAGGCTGAAGAAGAAAGGC
TGCGTCAAGAGGCAAAGGAGCGAGAGAAGGAACGGATCCTTCAAGAACATGAACAAATCA
AGAAGAAAACTGTTCGGGAGCGGTTAGAACAGATCAAGAAGACAGAGCTGGGTGCCAAAG
CATTTAAAGATATTGACATTGAAGTACGTAGCTTCTTTATACTCTTGAGTTCCCATTTGG
TTAATTTTGATATTTTTTCTGACTGGGTACCCATTTAAAGAAGTAAAGTAGGGGGCTGGA
GAGATGGCTCAGCGGTTAAGAGCACCTGACTACTCTTCCAGAGGTCCTGAGTTCAATTCC
AAGCAGCCACAACCATCTGTAAAGAGATCTGATGCCCTCTTCTGGTGTATCTGAAGATAG
CTACAGTGTACTTATATATAATAAATCAATAAATCTTTAAAAAAAAGTAAAGTAGGACTT
AATTCTAGAAAGCAGTGAGCTCAGCTGATAATTATATTTATCTTTAATTTGATGACTTGA
TGGTTCAGAACATATACTGCTTTTAACAGAAGACCCAGTCTAGTTTCCAGTACCCATAGC
AGATGGCTTATGACCGTCACCTGTTAATCTGTCTCCAACTTCTGACATTTAGGCATCTGT
ATCTGTACTCAAGTGCACTTAAACTCTTCCCCCATAATTAAAGTCTTCAAAAAATATTTA
AATCTTTAAGTCTTCTAAAAAAATATTCAGAGCCAGGACTTGTGGCACACGTCTTTAATC
CCAGCCTCAGGGAAGCAGAGGCAGGTAGATCTCTTGAGATCAAGGCCAGCCTGGTTGGTC
TAGGATAGCCAGGGCTGTATTTAGAGAAGTTCTGACTCAGATAAGTAAATAAAAATGTTT
GTAACAATTCTGCCTTTGTGTTGCCATCAGGACCTTGAAGAATTGGATCCAGATTTTATT
ATGGCCAAACAAGTTGAACAACTAGAAAAAGAAAAGAAGGAACTTCAGGAACGCCTTAAG
AATCAAGAAAAGAAGGTAAGAAGGTGGATTGATGGTTGATGTTCCCCCCTCCCCTTTATT
GTTACACAAAGTTTCCAAACTGACTTTAAACTGCTTTGCAAGTGAGATTGCCCTTGAATT
CTTGGTCCTTCTGATTAGTGGGGTTGTTAATCTTCTCATATAAGTTAAAAAGAGTCTTAT
TTTGGCCAGGTGGTGTTTGCATTCCTTTAATATCCTTGGCAGTCAGAGGCAGGCTCATCT
CTGATATGCTTTTTAGAGGAAGTTCCAAGGCAGACAACTATGCAGTCCTGTGTCTTGAAA
AAGCCAACAAAAGGGGTTATTTTGTAACACTGCATTTGTTTTCATCCCATTCAGATTGAC
TATTTTGAGAGAGCTAAGCGTTTGGAAGAAATTCCTTTAATAAAGAGTGCTTACGAGGAA
CAAAGGGTTAAAGACATGGACCTGTGGGAACAACAAGAAGAAGAAAGAGTAAGCTTTTCA
TTTCATTGTTGTATCACAGAGTGTAAGCTAAGTTATAAGTCAGCTAGAAAAACAGTTTTT
AAATTCTTTTTCTTTTAAATATTTATTTACTTAACATGTATGAGTACACTACAGCTGTCT
TCAGACACACCAGAGAGCATCAGATCCCATTATAGATGGTTGTGAACCACCATGTAGTTT
CTGGAAATTGAACTCAGGACCTCTGGAAGAGCAGTCAATGCTCTTAACCTCTGAGCCATC
TCTCCAGCACCAGTTTTTAATTCTTTTGTTAGATGTAATGTTTTAACGGCTACTGAAAAA
AGAAATGTTCACGATAGAGGTTAATTAAGAAACTATTAATTACAGCCTTATATGCACACA
AATGAGAGAAAGGACATACTTGTGGCTCTGTGGCATCTGCAGTCTCAGGGTCTACCATCT
GGAAAGTTAAAAGGATGTGTTGTTCTTTCTCTTTTTTAAAGAATAAGTTGTGATTTTGTG
ATAATTCTCCTCTGGTGTAAGTATTTAAGTAGAATTTGAAGACACTTCAGACAATATGAA
GGCTTTTGTATTTTCATAGGACTGAGAAAGAAAGTCTGACATATTTTGCCTTAATTTCCA
ATAAAATTAAACTGTTAAAAATCTCATAGGAATCATAAAAATCTCTTGACTTCTCTTAGG
GGGTCTGTTGGGATGCCCTGTTTTCACTGCAAAGTACAATGGGGAAGGAGACGCTTCTCA
GTATTAGAATCTTCTTGGGGTAAATTAGTAATATCATGTTTTGGAGATTACCCTAGTGTT
TTGTACTTTCAGATTACTACAATGCAGCTAGAACGAGAAAAAGCTCTGGAACATAAGAAT
CGGATGTCACGAATGTTGGAAGACAGAGATCTATTTGTGATGCGGCTCAAAGCTGCCCGG
CAGTCTGTCTATGAGGTGAGCTCACTGTTTTGTTTATGGAAAAGTTAATTGTGAACTTAG
TTTTCTTTTGAGGATTTTCCCTTAATACAGTCTGTCTTGAATTAAAGTTTAATAGGTAAT
TATTCAGTATTTGTATAGATGAGTTGGGAGATATTTTAATCTTCTCAAATGTTCCAAAGC
TGAAAGTTGATTCTTTTGTTCTTTTTGAAGTGTGGGCAGTTGAAAGTGGACTTTCAGGCC
CGCCATATAGCTACCTCCAGATTCGTGGTTTGGGTTTATTTTTTTTTTTTAAGTTTTATT
TTTACTATTCAGAAGTGAATTAGATCAGGGTCAGGCATCTAGGTACATTCTGTTAATAAT
AGCACCTGGGAATCAGCTTGGTCTATGTAGTGAGTTCTAGGACAGCCATGAGTATATAGA
GTGACCTTGTCTCAAAAAAGAAAAAAATTATATTAAAGATATTTTGTTAAAAGCTCTAAG
TCGATTTCTTTATTATAAGTAAAATGTGACCTTTTTGGGGGAGGAGGGGAGGTAAGGGGT
GGACTGGGAGTTGAATCTACTGCATCAGATGTGCCAGGCAAGCACTCAGCTCTCCGTGAT
ATTAGTCCAGTGTGTAGATATTATTAATTCATAATTTAACAAATGACACTACATTGCTTT
AACCATTAAGAGATTCTGCTTTTTTTTTTTTTTTTGGAGCTGGGGACCGAACCTAGGGCC
TTATGCTTGCTAGGCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCGAGATTCTGCT
TTTGTATTTACTTGGTGATCACTTTCTATGGCTTTCAGATTTTATGAACTTACAAGTGTA
AAACTGTTGTTCATATTTTATCTTAAAAATTTGACCTGTTGGGGGGGTAACTGTTCAATT
TTCAGGAGAAACTGAAACAGTTTGAAGAGCGTTTAGCAGAAGAAAGGCATAATCGCCTGG
AAGAACGGAAGAGGCAACGGAAAGAAGAACGCAAAATAACTTACTACAGAGAAAAGGAAG
AGGAAGAGCAGAGAAGGGCAGAGGAGCAGATGCTCAAAGGTAACCATGGTAACCATTAGA
TAAACTGCCTGATAGGTGCCATGTTTCATAATCTTACTTAGAAAACCAAGGGATCAGATA
ATGCAGTCCATTAAATGTGTTGGTGCTGAGTCCTCTATCAACCTATAGCTACATACTATA
CCTGGAACCCTATAAATTCACTAGATTTGTTCTAGTGTGGTTTCTCTTGCTGCAAAAAGC
ACATTGGGGGATAAAGAGAGGGTTTATTTGGATTCCATGTCATGGTCCATCATTGAGGGA
AGCCAGAGTTTCTGCCAAGGTACTGAAACAGAGACCCCAGAAGAAAGCTGCTTCTTTGAT
CACTCCCTGTGAGTTTCTTGGCTACCTTTCTTGTATAGCCCAGGCGCCTCCTGCCCAGGC
ATGGTATTGCCCACAGTGGATTCCCTCTCCTACAGCAGTCAACAATCAAGAACATATCCT
CACAGACATGCCCATAGGCCAGTCTGATAGAGGCAGTTCCTTGGTCGGTATTCTTCCCTC
CCAATTAAGCCTAGATTCGTGTGACTGAACAAAAATGCGATCAGTGTATAGGACCATCCT
AAATCATTGTGGACTAATAGTGTTTTTTTGGGGGGTGGGGGGGTTGTTCCTTTGTTTTTT
TAATCTTAATCACCATTGGCTAATTGCTGTCTACTTTAAATTTCTGTAAGTTTTTCTAAA
TTGGGTATGTGTGATGTGTAGGGGAGGGTGCATGGGTGAAGGTCAGAACCAACTTTGAAG
AGTCCGCTTTTTCCTTTTATTTTCATGCAGGTTCTGAGATTAAATACATATAGATTATAT
GTAAATGCTAGCCATCCTATTGCCTTCTTTTTTTTTTTTTTTTTTTTTTTTTTTGGTTCT
TTTTTTCGGAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGCAAGCACTCTACCA
CTGAGCTAAATCCCCAACCCCAAAACATCGTGACCAAGGGAACTTCTTTTTTTGTTTTTG
GTTCTTTTTTTCGAAGCTGGGGACCGAACCCAGAGCCTAGGCAAGCGCTCTACCACTGAG
CTAAATCCCCAAGCACCCCCTATTGCCTTCTAAAACAAGAGTGTATCTCTGCTTTAAACT
AGAATAGTAACCCTGATGGTAGGAAAAAGGTATGGGTGGGAAGCACATTTGAGTAACCTG
ATAAATTTTCATAGAGCGAGAAGAAAGAGAACGAGCTGAGAGAGCAAAACGTGAGGAAGA
ACTTAGAGAATATCAGGAGCGAGTCAAGAAACTGGAAGAAGTAGAAAGGAAAAAGCGGCA
AAGAGAGCTGGAAATTGAAGAAAGGGAAAGACGCAGAGAGGAAGAAAGGAGACTTGGTGA
GGATCCACTTTCTAGGAAGGTAAGTATAGAAGTTATTCTCTTTTTTTTTCCCCCTTTGGT
GCTGGAGCATGAATCTAGGCTTTATCTGGCAAATCCCCTATTACTGAGCTTTTGTTCATT
TGTTCTGTTTTAATTACATGTAGATACTGGCCTGATTTCTTTGACTACTTAGATACAAAG
ATCTGTTTGTATTCATTCACAAGGTCTCCATCACTTGGTAGAGATAATTGGGTCCAGTCC
AACTTCATTCAGGATGTATAGTACAACAATATAATCAGACTCCTTGATATTACTTGTATA
CAAAATGATTTATTTTTCTCACTTCTTGAATTCTTCTAATTGATGGTTGCGTTACCCCAT
AGTTCAGTTTTAATTAGCCCATGTGTCATTTCTTTATTCCTAAACTGTTTCCCAGTCATA
ATCTCCTTTTATACTTTCCTTCAGATTTGCTTCAGTTTTCATAATGGTGTGTCCCTTAAA
TCTGTTCTCTGTTCTCTCTGCTTCATTTGGTTTGTACTCATTTCCTAGAGCAAAAGGCAA
ACATACTTACCCTTTTCACCAGTTTCAGCTGTCAGCTTATGCTTCAACCACTCCCAGTTA
CTGCTTTGCCCTTTAAACAAAAACACTGTTTGCTTATTGATTTTTCCCCCTCCCCAATAT
AATATTTTAATAGATTTTTTTAGTTATGTAAATGGGGTATGTGCACATGAGTACTGAGTT
GTTGGATTCAGGATTCACTGAAGCAGGAGTCACAGGTAATTGTGAGCCATCTTATGCTAG
CGCTGGGAATTGAACTGTGATCCTCTGAAAGAGCAGTGCATACACCTAACCACTGAGCTC
TTTCCAGTCCCTAGTTTATTTCTGTGGGAGTACAGGGTCTTACATGGCCACAGCTGGTTT
TATGCTCCTGATCCTGTTGCCTCTCTGTCGTAAAGCAGTGAAGTTATAGCTGCAGTGCCT
CATTTTAACCAGTCTTATTTTAGGATCTTTAGGTTTGTTTAAAGAATGAAGTGCTTTATT
ATTAACTCCAGTAGTTGTAATCATAATTTTTATTACCTGTGTATGCACCTTTTTGCTTCG
TCTGTAGGACTCTCGTTGGGGAGATAGAGATTCAGAAGGCACCTGGAGAAAAGGACCAGA
AGCTGACTCTGAGTGGAGAAGAGGCCCACCAGAAAAGTAAGTAGAATCAGGGGATCAGTG
CACTTTTTCTTGGATCTTAGTGTCTGGGGTTTAAAATCAGACATGTAGAAAGAAGGAGAT
GAAGTTTCTGTAAGAATCGAATGCAAGTCCCATCTGTTATTTGAACCAAGGTCAGGGTTT
TTTGAAGGTTTAGGATGACCTTGAACTCCAGATTTTGTCTTTACCTCCCAAGGGTTGGAT
TTACAAGCTTGTTATGCCACCATGCCTGGTTTTAATCTTTGTAGTAATGGGTATAGAACC
CAAGGTTGGTAACTGTTAGCATAGCAAAGCACTCTACCACTAAGCAACTTGCTCAGTTCT
GGACTATTTTTAATGGTAACTGCTAGTGGTAGATGGGAACAGCAGCTTTAATTTTACGCA
GAAATTAAAGTTTAGAGGAAAGCTCATTGTAAAATATGGGTAATTTTTCAAGGTTATTAT
GTGATTGTTAGTCTGTGTTGATTTAAGATACTGAATTTTGCATAGTTTTTATTTAGAATT
TTAAAGGACCAGAATTAATGAATTTAGACTTAGTGATTTGTAAGAAATAGTAAAATCAAG
GATCCATATTCTTTTTGAAAAATTTGTCTTTAAAACTGTACCTTGTTTCTCCTCAGGGAG
TGGAGACGAGAAACTCGGGATGATGAGAGGCCTCACAGGAGAGATGAGGATCGGCTGAGG
CGCTTGGGGGGGGACGATGAAGAGAGAGAGTCGTCTCTTAGACCAGATGATGATCGCATC
CCCAGGCGTGGCCTGGATGATGACAGAGGGCCTAGACGTGGTCCCGATGAAGATAGATTT
TCTCGTAGAGGAACAGATGATGACCGTCCTTCCTGGCGTAATGCAGATGATGACCGGCCT
CCCAGGCGAATTGGTGATGATGACAGGGGAAGCTGGCGTCACACAGATGATGACAGACCA
CCCAGACGGGGACTGGATGATGACAGACCACCCAGACGGGGACTGGATGATGAGAGAGGA
AGCTGGCGCACAGCAGAAGAGGACAGAGGACCTAGACGTGGGATGGATGATGACCGGGGG
CCAAGACGAGGAGGTGCTGATGATGAGCGGTCATCCTGGCGGAATGCTGATGACGATAGG
GGTCCCAGGAGGGGGATGGATGACGATAGGGGTCCCAGGCGAGGGTTGGATGATGATCGA
GGACCTTGGAGGAATGCTGCTGAAGATAGGATTTCCAGGAGAGGTGCAGATGATGACCGG
GGGCCTTGGAGAAATATGGATGACGATCGGGTTCCTAGACGGGGTGATGATGCAAGACCT
GGTCCCTGGAGACCATTTGTCAAACCAGGTAAGAGTCTAGTATTAAAATTAAGATGCTTT
GTGGAATGTTTGATACATATTTATTAACATGTAAATGAAATTATAGGCCTAAATGGGAGT
TGTACCATATTCATTTGTGTGTGTGTATACACACATGCATATACATGTCTTTTTCCCTAT
GCCCATGCAGTAGCTTTTACGTAAAAATTACCCTTTTTAAATATTTATCCACACAACTGT
CCACCCATGGGGTCATACTGAGGAGCTCATTTTTGTTCTTCTAGTCAACTCTGGGCATGT
TCACCCATACTTAAACTTATGCTTTTCTCTATTCTCCAAATGCACACCTGCTCTTGTGAA
CCACTGTCTTAAATGTGTAAATTAGGAGTTCTCTGTTTTCTGTTTCATCGTTTGTGTTAA
GTCTGTCATTTATCTCAGCTCTTTTTTAAAAAAGATGTATTATTTTTAAATTACATGTGA
ATACATACCTACATATGGGTATGCACATGTGAATGCAGGTGTCCATGGAGGCCAGAGCAT
CAAATTTCCTGGAAATGGAATGAAGGCAGTTACTTAGCTATTAGCTATCTGACATGGGTA
TAGAGAATTGATCTGCAAGAAGATAGGCTGCAAGGAGATATACTGAGCCACCTCTCCAGC
CCTCATTCTGTTCCTTTGAACTCTTGCCCTACTATTGGTTTCTGCCATTTTTCCCCCTAC
TGCCAGTTCTTTCTGCAGTAATTAGTACTTTTTTGCCTTTACCAGTTGTGATAATCTGGG
CAAACCTTTTTGTCTTTTCTTGCCTTTGGTCATATTTCACTGTCAACTATGTGATCTTAG
AGTAAGTGGCTTCCATGTCTTTTGTAAAATGGGATTGACAGTATGATAGATACTCAGTAA
ATTGTAGTGTGTCCTATAAAAAGTTACCAAGTATTGAGGAATCCTAGAAGAAATACAAGG
TTAGGTATCTTTATATATTCTGTTATCCATCAATACATAATTTGTTGATGTGTTTCTGTT
TGAATCGCTTTATTAGATGTAGTACTGATTTATAGTAGTCAGTCTATGGCCAGCCGTCCT
GGTAACCTTAACAGTCTGTCTGATACCCTTTTGCTTTTAAAGTTGGAGATTGTACTTTAA
CCTTTGCTTTGAAGGTTATTTGAACAGTGAAGTAACCAGGAAAAATCATAGTATTAAATA
AGTGGGCCATTAAAAGGACTTTTTTTTTTAATAGTAAAAAGCTGATTTCTGGGAGGCAGA
GTGCTACCAACTTGAGCTGGTATCACATGTGTCAGGAGACAACTTTTTCGCTGAACTGAA
TGATTGTAAAATTGCCATAAGTATTATGCAATTATAAATATTTTGGATGTAATCTCTGCA
TAATGGCACATGCCTTTGATCTCAGCACTCTGGAGGGAGAGGATCTTTGTAAATTCAAAG
TTAGCCTAGTCTACATGGCAAGTTCCAGGACAGCCAGGTATACATACAGAAACCCCATCT
TTAAAACAACAACAACAAAAACCAAAAAACCCCCAAGAATTTGGCAGTGATGATGATTGA
CTTAAGGAATAAACAAGTTAATATAAGTGGGATTTAGTCTATATTTTTGCACTCGTTGAT
ATGAAAGTCAGGTACAATGGTGATGATTAGCTTTGTAGCTTTGATGCATTAACAGTGAGA
ACATACCTCGCTTTGACCACTTGCTTCATGCATAACACTGGGCTGAATCAAAGCATTTAT
TCTTGTTTTATGACTGGATGGTCAAATGTCCCAGAGGACAGGACTAAGGAAGAGTCTTTG
ATAGTGTTACAGGGTTTAAATTCATAATTGGGTGGTCACTCCAGTAAACTCAAGCAAGTT
ACCTGCTTAACTGAGTAGTCTAGTAAAATTAGATACTGGCAGTCAACATACACAGCAGGA
AAAATTTGATAGTATCTATTTTATGAAACACTACATCCAGACTGTTTAAGTTACCTTATA
GATACATAACTCAAAAATTGTAAATGACCAACCATTCGTGGATACACATGATTTTTGTTA
AAGGGGGGAATTCAGAGTATCTTCAATTTATGTTTAGGATGATGAATTAATGCTAGGATA
CCTTTGTAAAGGGTGGGGATGAGCTCAGATGATAGAGCATTTTCTTAGAATACATAAGGC
CTTCTGTTAAACCCCCAGCAGCACCACATAAACCTACAATTGCTTCTTTTTATAAACTAG
GTGGATGGAGAGAGAAAGAAAAGGCTAGAGAAGAGAGTTGGGGTCCACCTCGAGAATCAA
GACCACCAGAAGAACGTGAATGGGATAGAGACAAAGAGAAGGACAGAGATAATCAAGATC
GAGAGGAGAACGACAAGGACCTTGAACGTGATAGGGACAGAGAGAGAGATGGGGACCGGG
AGGATCGTTTCAGAAGACCCAGGTTAGTAATGACCTACTGTGGTAACAGGTTTCTCTCAA
ACTCTGCTGTGCATTCCAGATCACTTCTGAGAAATACTGCTCTGGTTTCACTTACCACTT
AGGTGCACATAGAGTATGAGTGATTAACACTCCCTTCCCCCATGTAGAAAATGACAATAT
TGGGTTTAACCTGTTGGCTGCTTGCAGGTTACATAACTGGTAAAGGAACCAGTCCAGACA
TCTACCATTCCTACTTCTTAGAACAATGACTCAGTTTAGTTTTTTTGTTTTGTTTTGTTT
TGTTTTGTTTTGTTTTGTGAAGATGGCATCTTTCTGTGAAGCTCAGGTTGACCTGAAATC
CAGTTTTTATCTAATCCACCTATGTTGATCTATAGTCAGTTGACAACACACTCAATTTTT
ATTAGTAGTGAAAGTCCTAGTTTGTTCTCTCTGTCTTAATGGCTTTGCCACTAACAAATC
TAGTAGAAAAAGCTCTCTGTGTTATTTATTTAGCATGGCAGCCAGCAACTTTTTTGTGGC
TAGTGCACTAACTCTTGGAATATGGGTTGTGGTTGTGCCACTGTAGGATCTTTAGGTAAA
TAGCTACAGGTGACGTATGTTTGCTTTCTATGCCTCAGATAACCAAACCATATTAACGTG
TTAGTTAAAACTCAGATTGATAAACTTAGATTAATAAACTGAATTTAGTGTGTTGCTTTT
TTTCCCCTCTCTTTTGGGGGGTTGGTTTGGGGGGATGTGTCTATCCTTGAACTCACTATA
TACCAGGCTAGTCTGGAACTCAGAAATCTGCCTCAGCCTCTGAAGTGCTGGGATTAAAGA
TAAGCAGTAACACCACCCAGATGGTGTGTTGTTTATTATTATCCATATGTTCTGTGAAGA
ACTGAGCTTGTCACTTTAAATGGCCACAGGGATGAAGGTGGCTGGAGAAGAGGACCAGCA
GAAGAATCTTCAAGCTGGAGAGATTCAAGTCGCCGTGATGATAGGGACAGGGATGACCGA
CGGCGGGACAGAGATGATCGTCGTGATCTGAGAGACCTGAGAGACAGAAGGGATTTAAGA
GATGATAGAGATCGGAGAGGCCCTCCCCTTAGATCAGAGCGAGAAGAAGGTAGAGATATT
TTGGCTGTTGGAATATTAAAAAACTGCTTATGGCCCGATGGGGGCTTTATAATTGTCTTA
AATTAATATGAACCCTGATGATGAGTAAATTCAGTGTACTTGTCAGGTTGTGATGTAATC
TCTAAGGTGAGTGTAGCAGTAGACTTAAATGAGAGGCAGCAGAAATTGATATTAATAAAA
TGGAGACAGCATTAATGATGTAAGATCCTTGTGGATAAACACAAGAGTATAAATGTGGAG
ACATTAGGGCTGGTGATATGGCTCAGTGAAGAGGGGCTCTGTGTTTTCTCTCTCCTAACA
ACTTGACTTCAATTTGGGAGATCCACATGGTAGCAAAAGACTGCACTCCCTGAAAGTTTT
CTTCTGAAATCTACAAATTCATATCCATAAGTACTTGTAGTGATATTAACGTGTCCATTG
TACTTATTTTCCTCACACACTTTTAAGTTTGCTCAGTAGAATCAGAAGAGTATTAAAACT
AATTTAAAATCTCACATTTTATTTTGTCCCTTTTTTTTTTTTCTTTCCTGGAGCTGAGGA
CCGAACCCAGGGCCTTGCACTTGATAGGCAAGCGCTCTATCACTGAGCTAAATCCCCAAC
CCCAAAATCTCACATTTTATAACTTACTTGAAAAATTCTTCAAGAGCCAAAAATATTTTG
ATTTAACAAATTTAGATTTTTTTTTCTTACCCTGTCAGGTTTATGACCATTCAAATATTT
CGTTTTCTTTTTTTAAAAAATTATTTCTTTATGTATATGAATACTCTGTAGCTGTCTTCA
GACACACCAGGGGGGGCATCAGATCCAACTACAGATGGTTGTGAGCCACCATGTGGGTGC
CAGGAATTAGCTCAGGACCTTTGGAAGAACAGCCTGTGCTCTTAACCACTGAGCCATCGC
TCCAGCCCTTCCAGTTTTCAATTATGTCTGCAAGTTCAAGACTTTGGTCAGAAATGACAC
AGATAATTAAAGTGTGGGGGCTATTAGTGTGATTCTGAATTGTTGGTTTTCTAAATAGTT
TCAGGCAGGCATTTCTTAAGTTTCATTTCTGTTCATTTTGAACCAATAAAAATAGTTCAA
GCCTACACTTAAAGGTGTTTGAACTTTTCTAGCAAGCTCCTGGAGACGCACTGATGACAG
GAAAGATGACCGGACTGAAGAAAGGGATCCACCTCGTCGTGTTCCTCCCCCAACTCTTTC
AAGAGAGAGAGAAAGAGAGAGAGATCGAGAAGGTGAGAAAGAGAAAGCATCTTGGAGAGC
TGAGAAAGATAGGGAGTCCCTTCGTCGTACTAAGAATGAAACTGATGAAGATGGATGGAC
CACAGTACGACGTTAAATCACAAGACGATGGAGTCAAACTTGTGGTTCGCATAGGTTTGC
TCACATTCAAGGATTATTATACTTGTGCTTCAACCAGTCTAAATTGAATTCTTTAATGTT
GTCTCACCATAACACAAAAAGCATGAACTTGTATTAATCATATATAATAGATTGATCATG
CACTGTATTCACAGGAGGTTGTAAAACCATGCCATTTTCTGGAACTTAAGGTGTTGCATT
ATTTCATCAATCATTTGTTAAAAAAAAAAACTAAAAAATAAAAAATGTGAACCCTTCAGG
TGTAAACACCTTATCTTGGTATACAATTGATCTTTTTTGTTTTGTTTTGATTTTGAAGTA
TCAGATATTAATTTGGAATAAGGTAAGGTTCTCTTGAAACATTTGAAAACCCTTTAAGAC
AACTGATCTGTCAGCTTTCCCATCAGTAGTAGTGGGAATATACCTTCTTAGGTATTTACT
GTTAAATATATTTAGGCAGTTTATAGCTTCTGATCAGTGTGGTAGACATTACAAACACTG
GCTGTAATGGGGTTTTCTATAGACTTACTTGAGAGAGGTGAGTATAAAAGCATTTTTTAG
TCATCATCATGACGATGCTGCTCAAGTGCAGGTCCAGAACAGTACAGCTTTGGGTCCCTA
GAGCATTTGGTAAACTGTTGTGGGTTTCTTTTTTTCTGTTGCCAAAAGAAAACTGCTTTT
CCACTAATTCATGCCTTTCAAGCATTTTAAATATGACAATATTTATAAATGTGTGGTTTG
GAGGAATTGTTTAAATTCTTTTTCCTAATTTTCTTCAGGATAGATTATTTCAACAAGTAA
TTTGTAGTGATGACTGTGTTGACTTCAATTTTGGAGTGTGTAGCTGTGTTTTAAAAAAAA
AAAAAAGTAACCATTTGGTCTTATTGAAGCCAACACAGAACTTGCTGCTGTGTTTTATTT
CTTTGGTGATAAATAAAATACTTACATAATTGGTGTTAGTGTTGATTTGTTGATGGTGCT
ATGTTCCATATATTAAGTTTCTGTAAATTTTTATCAGTGCTGTTATCAACGGAAGCAAAT
AGTAGCAGCTAGCAAGTTCTTGTTCAGAAACATTTCCTTGGGTTTCATCAGGAATTAGGG
GGAAAAAGCCAATAAATAGTTAGAGGATTTTTGCAACAAACTTACAGGCTCTGTAAGCCT
ATAATTTTTATTAAGTAGTGGTTTAAAATACTATACTGTTAAAAGCGGTCAGGCCAGAAG
AGTAGATAGTTCTACTTTGGTACCAAGGCCTGAAATTTCAAACATGGAAGTTTTGTTGTG
GCTAGAGGGCTTACTCAGTCAAAACAAGTAAAAGTACTTACAGACTACTTTTTTTGTTTG
TTTGTTTGTTTGTTTTTGGTTATTGTGGGTGTGCTTGTTTTAAAGACCACTGGTTTTATT
TGTGGCCGTAACCTGCCTATGTATGTTTTCACTCGTGAGCCCCAGATGCTGATGCCATAT
CTGATCAGCTACATTTAGGTGAATGCAGAGTTTGGGGAGCAGGTTTTCCTGCAGACTCAG
CCTTGCAGCTCATTTGGGGTTTCCAGATGTTTTCTGCTTTTTGTTTTGGGACAGAACCCA
GAGAAAAGGGTGGAGGCAGAAGTATCTGATGCTTTTGCTTTGTGGTCTAGCTCATGGGTT
CCTACTACCACAGTTCTTCTGCCACCAACCTAGCAGCATTAAACAGGTTAAAGGAAAGCT
GACTAATCTGGATGTGTCAGGTGAACCCTGTGGCTTCTGCAGTTGTAAACAAATGGAGCT
TTAAAGCATCTACAGCTGTGCTTGAAGGTAGAGAGACCCCTTAGATCTACATTAAGCTTA
TCTATAGATTGCCATCCAGGAGGGGGATCAAACGGGTATGTTAGTTAAGAACCACCAGTG
TCACATGGCTTGTAATACCAGAATTTTCCAGGTCAGTTCTGGCTGGTGAAACTTAGTCTT
AATGTTTTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 8633..8823, 8974..9110, 9454..9617, 9975..10178, 11884..12088, 13852..14023, 15017..15121, 15460..15558, 16897..17013, 17203..17388, 17855..18202, 18930..19034, 19374..19487, 20292..20414, 21305..21458, 22634..22818, 23887..23975, 24596..24876, 24905..24906, 24912..25287, 27480..27681, 28589..28788, 29912..31110
1001..1049, 8633..8823, 8974..9110, 9454..9617, 9975..10178, 11884..12088, 13852..14023, 15017..15121, 15460..15558, 16897..17013, 17203..17388, 17855..18202, 18930..19034, 19374..19487, 20292..20414, 21305..21458, 22634..22818, 23887..23975, 24596..24876, 24905..24906, 24912..25287, 27480..27681, 28589..28788, 29912..30132
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved