Rattus_norvegicus Locus LOC363929
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus LOC363929
Rattus_norvegicus
LOC363929
1
SNORA52
2137..2270
4278
TCCCTACCTCTATGAGAGTGTTCCCCCACCCACTCCCTCCCATCTCCTCACCCTGGCAT
TCCCCTACAAGGGGGGTGGGGTTTGAGGGTGGGCGGCATTGAGCCTTCACAGGGCCAAGG
GCCTCTCCTCTCATTGATGCCCGATAAGGCCATCCTCTGCTAGGTATGTGGCTGAAGCCA
TGAGCTGCTCCATGCGTACTCTTTGATTAGTGGTTTAGTCTCTGGGAGCTCTGGTTGGTT
GGTATTCTTCCTATGGGGTTGAAAACCCCTTCAGTTCCTTCAGTCCTTTTTCTAACTCCT
CCATTAGGGACCCCATTTTCAGTCCAATAGTTGGTTAGAACATCTGACTATATTTCTCAG
GCTCTAGCAGGGCCTCTCAGGAGACAACTATATCAGGCTCCTATCAGCATGCACTTCTTG
GCATCCACAATATTGTCTGGGTTCGGTGACAGTATATGGGATGGATCCCTGGATGGGGCC
GTCTCTGGATGACCTTTTTCTCATTCTCTGCTCCAAACGTTGTCTCTGTATTTCCTTCTG
TGAATATTTTGCAGAACCACAATTTGAACTCCTAGCTACCGACCCAGCCCACGTGCAACG
AGAAAAGGGTAGAAGGGAGGGTACTTCCGGTATTAAGGTGTTACAGTGATGCATCTTGGG
ACTTGTAGTTCGCCTCAATACGACCTGGGCGGGGCCTCCGCATTGCACGTTGGGAGCTGT
GGAGCCGTGTGGCATGCTGGGAACGTGAGGCGAAAAAGGGGATTGAAAATTTCGCCCGTG
TCCCCATGGATTTCGGGAGACTCTCGCCTATGTTACAGGAGCACTTGGCACTTGAAAAAA
CTCTTGTTTTTGTTGTGGGAAACACATGACCGGGGACAAGGCAAATTTCTTGCTTCCGGC
GCACCCTTATCGTCAATGGGAGGCGCCCCTCCGCGGCGCCTTGCGCGTCCCGGAGACTTC
TGGGTAGCGGTTTACCCCCGCCCACTGCGTCAGCATCTTCCTTTCGCCGCCGGACGCCGC
CGAGGTCGCACGCGTGAGGTCTGTCCACCGCAACCGAGTGAGTACCCTGGCCGGCTGGGG
CGCAGATAGTGGTTGGGACTGAGGGATGGACCGCGGCCGGGAGCCGAGGGTTGCATATTT
TCCGTGATCGGAGGCCTGGTGCCTCACATGGTCTCACTTGCTGGTTAACAAGGAGTGGGA
AGCAGAAGGCCTCTAGGGAAACCTCACCACCGTACCTTCCTTCTCTCTGTCCCATTCAGC
ATGCGCTACGTTGCCTCTTATCTGCTGGCCGCCCTCGGGGGCAACTCCAATCCCAGCGCC
AAAGACATCAAGAAAATACTAGACAGCGTGGGCATCGAGGCGGACGATGAACGACTCAAC
AAGGTAGCTTGCTGCTCACTAGGACCCACTGGATCCAAATGTCTACTAGTAGCGGTCCTT
AAAATGTTAGGTCCGGATTTTACCCTTAGAGAAAATGTATAGGACCTGTTGAAAAGGGTG
GAAGGAGGAGGCCTACACCCGTCTTAGTCATAGTTTTCTCTTTAATCCTTTTGAGGACCT
TGTGCAGTCAAAGAAATCCGGGCATGACAAAGTCCTGCTCATCGTGCTTTTGTAGAAGTT
TAATACAACTCGCTTGTGGGACTTTTGAGATCAGGTTTTACTGTGTAGCTCTGACTAACC
TGGAACGCACTGTGTAAACTAGTTTCCTTAACTTTTTCCTTTTTGAAACTAACTTGGCAG
TAAAGGATTTACGCCCACAAGTGAGAAACATCTGGTCTCCCTGGATCTATAGTTAGGGTT
AGCTGATAAATGTAAGTGCTGGGAGTCAAACTCTTAAGATATGGTGAGTCCGAGCTGTAC
AGTGTGATCTTACCTGGAAAAGAACAGGTCTTCACAGAATCTTAGAATTTTAGTACCTAA
AACTTGCCACTGCCAACATCTTTGTTGAGAAGACCCAGTACTGTCTCACGGCTAGTTACT
GGGGTAGGGTACAAGTAGGACACCTTCCCGTGTCTGTCTGTCTTGCATTACTGACTGCTG
GTTGTGGTTGTCTATTCCAGGTCATCAGTGAGCTGAATGGAAAGAATATTGAGGATGTCA
TCGCTCAGGGTGAGTTCCTGGGAAGTGAACATGTTTGTGGTCCATCCTAATCCCTGCTGG
TCAGCCCGTGATCTGCCAGGCTTCGCTTGTGGACCAGAGCATCCTAGAAACCCTGCCAGA
GTTGTGCGAGGCCTTTTTGTGTGCTTGTGCCGGCAGCGCTTCTGAACACGCTGGAGCTGG
CAATGGGGTCATTTGTTGATTGCTCCTACCAGGATGTGAAAGCCTTTTCTGTGAGCAGGG
ACTGGGGGCGCTAAAAATTGGTGCAGGCTCTTTCTTAACTTTTATTAGGCATACAGATTT
CTGGTACCACCAGACTACGTCTTATTTGCAATCTGAACAGTTAACTGCACACGAGAAGCA
AAACCAGCTCAGCAACTGACCTAGTCTGTGAACCTCACCCCAAAAGAGCTTTGGGCATTG
GGTCACACTCATGGTAAACACGTTCTCTTGATTTTTAGTTGATTTTTAGTTAACTAAAAG
TTTGTGGGTTTTCCTTTTTTTTATTTTTTTAAGATTTTATATAAGTACACTGTCTCCATC
TTCAGACACACGAGAAGAGGGCATCAGATCTCATCATAGATGGTTGTAAGCCACCATATG
GTTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCTCTTAACCACTGAGC
CATCTCTCCAGCCCGGAAAACAAGTCTTAAACAGTATTAATGGTGTTCCTAAGTGTGTGC
AAAGTTGCATTGTGTTTTAGAGTGAAAGCAGGTGGCAGTGGTGTTCCTTGGGTTGGTGAG
TCTACCCTTACAGAACAGCCTTTCTGGCTGGGTCTCTGTTCTGTCTGGTCTCATGTTCTT
TCTATTTTAACATAGGTGTTGGCAAGCTGGCCAGTGTGCCTGCTGGTGGGGCTGTGGCTG
TTTCTGCTGCCCCTGGCTCTGCAGCTCCTGCTGCTGGTTCTGCCCCCGCTGCAGGTAAAT
AGAGGTCTGATGAGTGGGTGGTGATCAAAGGGGGGTTGGTGCTCAGAGTTTGTTTTATTG
TTGGCCGGGGCTCCTGGGAAAATCTGGATGCTTACTATGGTGTTCCTCCACAGCAGAGGA
GAAGAAAGATGAGAAGAAAGAGGAGTCTGAGGAGTCGGATGACGACATGGGATTTGGCCT
GTTTGATTAAGTTCCCCTGCCAATAAAGCCTTTTTATGTATTTTGAGTGGCCTTTAAGCA
CTTTGTCAACGTTTAACATACTGTGTCTTCAGCCTAGGCTCCACGCAGAGTGTGGAAGTA
TGTTGGGTTAATGGGGAGGAAGAGGATCCCAAGGTCCATTTACTTAGGGCCTTGGCTTTA
GAGAACTGTCAGACCCTGAGATGGATCTTTGTAGCTTTCATTAAACATTCTTGGAAAACG
GGTGTGGAAAAAACCGTGACCCTGGATTGAACTGCTACTTAAGTTTCCCTATAAGGATTG
TGTCAAGGTATCATAACTTTTCAGAGTGTTCTAGCTACCTTCTGGCCAGTTCTCTGCATT
GTTCATACTTTGTCATCTGCTGGCTATGAACTTCCAAGGCATACAGGCTGCTATATGGAC
CTGGTGAGACTGCAGCGTTGAGGGTCTGTCAGTCTTAGGGAGACAGATGGCTTATTTTAA
GAGGTTGGAGGAGATGCTTCCTGTGGCGAGCATGGAGCCAGGAAGGGTGGTGGATGTAGA
AAAGACACAACTAATCCTTGAGGTGAGCTATAAGGGAGCAGGTAAAAATGGGGCTGGGGG
GTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGGAAGCACAAGGCCCTGGGTTCGG
TCCCCAGCTCCGAAAAAAAGAACAAAAAAAATGGGGCTGGGGTGGAGGGTTTCAGGGTCT
CAATTCTAGTCTGTACCCTGAAGGAAGGGAGGAGCTAAGGTTCATGGGAGTTATCCAGCC
TCAAGATTCTGAGAAAGAGCAGCCCTGTTCTTGGCGCCAGCATCTCCCAGGGGCCTGAAG
GGTGTGTACCCAAACAGCCTTACCCTCTGTGGAAATGAGAGCAGAGGTCCCTCTGAGCCA
GGGCAGCACTGTCCTTCAGGCCCATTACTGGAACAAAATAGTGGGGAGGACCTTAAGTTC
TTAGCAGCTTCTGACCACCATGATAAGCCATGGGCTTACTGCGGGTTTGTTTCCACCATA
CCATTACCCTAAACTCATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1056, 1259..1382, 2060..2108, 2955..3053, 3173..3278
1260..1382, 2060..2108, 2955..3053, 3173..3246
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved