Rattus_norvegicus Locus Rps13
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rps13
Rattus_norvegicus
Rps13
1
SNORD14
1876..1962
4423
TGGGTTAAAAAAAAATGCAGCTGGGCATGATGGCTCAAGCCTTTCATATCTCAGCTTTA
TTATTTTTTTTGAGACAGAGGCAGAAAGACTTCCGTGTGTTTGAGGCCAGCCTGGTCTAA
AAGGCGAGTGCCTGGACAACCAGAGCTACACTGAGAGCCCCTGTCTCAAAACAAAAAGGA
AAAATGGATCAGTGTTTCAGTACTATTTTAAACCTCTCACCCGTCACTTGTCATCAGTCT
TGTAGATCTCAGTTTCTTCTTTCTTGGGTCCATGCTTTTGTTGTTTCCTGTTGCATTTAT
AATAAATTGTTCTATTCATCCATTCTTGGAACATACCGTGGTGAGATCAACTCCAAAAAA
AAATCAACTCTTCGGGGTAGTAGCCCTTTCCCTCTCATCTTCTCTCCTAGTTCCCAACTC
CTCCATCCAGAGCCCGCGCGGTTCTGTGCTCCGCCCAAGTAGAACAGGCGCGCAGGCAGC
TAAGGCCAGGTAGGGGCGGGGCTTGGAAGCCTGGTGTTAACCATCTAGAGAGAAAGGGAG
GCGACGGCTGCACAAGGGGTATTGCTCTCATCCCGTACCGCACGAGTTCGGGGATTTAGG
GGGAGGCATGACGAACCACTCGAACCCGCCCTAGGTTCCCTCAGACGCAACTTCTGAATA
GAAGGCTGACTTCCCGCTCGGGCCCTCAGCCCGAGCAGAGACTTTGACGCAGGACGTAGT
GGCCCAACTAAAGAATGAGGTGTGACGGTTGGGGATTTAGCTCAGCGGTAGAGCGCTTGC
CTAGCGAACGCAAGGCCCTGGGTTCGGTCCAGCTCCGGGGAAAAAAAAAAAAAAGAAAAG
AATGAGGTGTGACGTATGGCCGCAATGCCTTCTGGGACGCGTAGTCATGTGGGCTCCAGT
GGCCACACAGTGTAGCACCGCCCCCGCGCGAGAGGAAGCGTTCCTGCGTGACGTCAGTTC
CGGTGCGGCTTGACTTCCTGTGCCGTTTCCTACCTCGTTCTCTCTTTGCTTCCAGACCTC
CGCCATCATGGGTCGCATGCACGCTCCCGGGTGAGCCCGCCGGGCCAAGTTGGGTTGCGG
GGTTGGGGCGCGGGACCGGGAGAGCAGGATGCGGGCTGCAGATGGTGGGACAGTGGGGCT
GCTTGGGGCGCGGGCCACCACCTTACTCCCTATACTTATGTTCTCAGGAAGGGCCTGTCC
CAGTCGGCGCTGCCCTACCGCCGTAGCGTGCCCACGGTGAGTAGAGGTTAAGGGTTGGAG
GGAGACGTGGGAAGCGATCTGTGCGCAGAGGATGGGGCCCGAGGTGGAAGATTGTCGCCG
TGCTTTCTCATCCTAAGGCCGATTTTTGTTCCATCTACAGTGGCTGAAGTTGACGTCTGA
CGACGTGAAGGAACAAATTTACAAGTTGGCCAAGAAAGGCCTGACTCCTTCCCAGATAGG
TGAGTGTTGATGTAATCTTTACCTTCTGCTCTCGTGTGATCTGAAAAAAACAAATGTTTC
TAGTCCATGTGGTAAAACGAATTTCCTGCTTCCACAGCTGAGCCCGGACCGTCTGGGATT
GAGTCACATCTAACTGAAGTGACTCTAACCTGCTGTGACTTTGTACAAATGAGAAATAAC
TCGTTTCTATTATCATGGTTCTGGAGCCTAGGATAACTGCTTCTAGGAAGAAATTATCCT
CTTTAGGACATAAAGTACGCTAGAAATATGCAAAGACAGCCATTTGAAATAGACTCAGCT
GATCTGAAGTAACAAGAGGTTTAGAAGTAATAACATGCAGTTTTAAAAATTGATATAAAT
AAATGCTCCTTTTAGTTAACACTAAATATAAAGGTAGAAATCATTGGTTCCTGTGGCCAG
ATGTGTTCTGGCAGGCTCACTGTGATGATGGTGTTCCAACATTCGCGGTTTCCACCAGAA
GGACATTCTGTGTTGGGTAGACCTTCCTTGGATGTCTGAGTGAGCAGGAGATTTGGAGAG
TTTTGCTGTTGGGGATTTATCACATGCTCAAGGGTGTGTGTGTGTGTGTGTTGCAAGTTA
CATGTTTCTCTTTTCAGGTGTGATTCTGAGGGACTCACATGGTGTGGCACAGGTCCGTTT
TGTGACCGGAAATAAAATCTTGAGAATCCTTAAGTCCAAAGGCCTTGCCCCTGATCTTCC
TGAGGATCTCTACCATTTGATCAAGAAAGCAGTTGCTGTCAGAAAGCACCTTGAGAGGAA
CAGAAAAGTAAGCAAGACAATAAACCTGGTATCATGTAGAGACGCTGTACTGGTCTTCAG
AGAGTGGGATGCGTTTAAGTTGAGTCCTTTTGTGTGATTGGGGATACTAACTAGTGGTCA
ACATGATAGTTTTCCTTGAAATGGGTGGTTTGATTTTTAGCTCCCCTAAACCTATCCAGT
TGGTCTCAGATGCTGGGCTCTTTTGTAGATTTGTGACTATGGGTCTTATTCTAGGAGCCC
TTAATTTCTTGAGTTTGAGACCACCCTGGTCTAGCAAGTTGCAAGATAACCAAGGCTGTA
TAATAAGAAACCCTGCCTCCTTTAAAAAAAAAATTGCCTTAAGGACTTACCCTAACCATA
GAAGGTATTCATTTTACTTGGTGGTGGTTTTCTTAGATGTCCTCTATTTTTAGGATAAGG
ATGCTAAATTCCGCCTGATTCTAATTGAGAGCAGAATTCACCGGCTGGCTCGATACTATA
AGACTAAGCGGGTGCTCCCACCCAACTGGAAATAGTAAGTATATAGGTTTTTGTTGGCAA
ATCAGCTAGATAGTAAATAATGGGTGGTGGTAAGCATTTTGCCATTCTGGGTCCACTTGT
TAAGTGCCATTTCAGTTCATCTCTGTCATGGTGGGAAAGCTTGCATGGGTAATATATGTA
TGATCAAATGACAGTGTTTGTCAAAATGTTACCTAGAGGCAAGCTGGTCTTTCAGTTTAA
GCTGACCTAATCTACAGAGTAACTTCAGGACAGCCAGGGCTTTGTTTTGGTTGTTTTTTG
TTTCTTTAATTTTGTCTTTTTAATGTTTCCTTCTAAAAGAAGAGGGTCCTAGTTGGCAGG
CTCTGGTTAAACCATGAATGCACACACACTCCTCCCCTTGGTGTGTTCCATGAGTTGCTC
ACTATGATGATCATACAAACGTTGACAGTTGGTCCAGATAGCTATTTCCTTGTTTTGGCC
AGTTAGACTCGACCTTAGATGTCTGGCTGAGTACTGCCATTCATCCGCATGTTTAAACCT
TTGGACTTTTGGGTTCTCCCTCAGTTTGATGCAGTGTGTACAGTTGGTTAGAGAGTTGAG
TGGGTCCTGGAGTCCAGTTCTAATCCTAGTTTCTCTTCCATTTTTTTTCCAGTGAGTCAT
CCACAGCCTCTGCTCTGGTGGCATAAATGCTGTTGCGTACACAAGCAATAAAATCACTTT
GAGTAAATTCATGTTTTGTGTTTCTCTGCGCCAGTACTGCATGTGTTGATGGGAAAGTGT
TTCGGCAGAAAGGTGGGATCTGCTGGTGGCTTCCCTGGCCACTTAAACTAATGACCAGTT
GGTGTAGAGTCTGGTGGGGTGTTGCTATCACCATGTAGGAGAGCTGTAAGACTAGGAAGT
GGGGTGTGTTCATTGTGGAGATTTGAGTCCTCTGGTTATATTCAGTGTTTAAGGTGAGCC
TGGTGTGCACACTGCTAGCTGTGAGGCCGATTCCATCTTGCGGGGGGGGGGGTCTTAAGG
AAAAATGAAGTCTGTACGTTCTAATTTGGGGAATGAATTTATTAAACTTTGGCTGCGTTA
CAGTCATGCAGGACTTTGAGAGAGTGGAAGATAGAGTTGAGTCCCTGGAGCTGGAGGTCA
TAAGTTGCCTTGTGCTGGGAACTGCAAGAGCACCCGATGCTCTTGGCTCTCAAGCCATCT
CATATATAGGTTCACTGTCGCTGTCCTCAGACACACCAGAAGAGGGCACCGGACCTCTTT
ACAGGTGGTTGTGAACCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAGAG
CAGTCGGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCTAAAAATATTTATAAACTGGT
TGGTAGGCCAACAAAATTCAACATGTCCTGTAGTCTGAGTGTAGACAACAGGATGGACTT
AAACTCCACTTTCAGGAAAAGTCCTGACCCTTAGAGATTGTGTTTAAGTGAGGTCTCAGG
TTGCCAGGACAGTAGCCACACTATAGACTGAAATATTGGTCTCAGGCAGGGCTGATAGGG
TTTGGTAGGTTATGGTGCTGGGCAACAAATCTGACAACCTGAATTTGATCCCTGGAAACC
AACTGGAAGAAAGAAAAGCTTGCATAAGTGGTCCTTTGAATTTAAAACAGGGTGAAGTAC
ACACAAATGTTTAAAAACATCTTAGTGACAGTGGGATGAGATGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 1187..1235, 1360..1438, 2057..2226, 2633..2733, 3352..3423
1027..1049, 1187..1235, 1360..1438, 2057..2226, 2633..2733, 3352..3382
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved