Rattus_norvegicus Locus RL27A_RAT
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus RL27A_RAT
Rattus_norvegicus
RL27A_RAT
1
SNORA3, SNORA3
1514..1643, 2586..2716
4039
AAGAAAAATGTAATTTAGTAATTTGGAGTTACATGCCAGATTGTGTGGTGGTTCAAGTA
AACAAGTAACAAAACAGGTCCAAAAAAGTTCACGCAGGAATCGCTTGCATGAGGAACACA
CCGGGCTGGGAACCTCGGGTCCAGAGGACTAAAAGCTTACCAGCCAGATTCTGGAGAAAA
TTCAAATGTGTTTATAGAAAATAGTTCAAAATCTAGATCCCTGAAGCGCAGAAGGCTGTT
CAAATTTGACAGGACAAGAGCAAAAGAGAAGGGCAGTGTCCCTTCAAGGGAGACCAGAGG
ACCTGTGGAAGTTTTGCAGATGCTCTGAGACACCGCCATGGCGGCCAGGAGACAGAACCA
ACAGCGCCAGAAGAGAGCATTGTACTAAGAAAACGCCCGCCAAGCCCCAGAAAGAGATAA
GCATGGTGGTAACCGCGATTCCCGGGGGCGGGCGCCACCGCTTACCCCGCCCACCCACAC
GGAAAGGAAGAGGCGGGCGCCGGAAGTCGCTGACGTCTGAGCCCCTCCCGAGGCCAGCTT
CTGGGCCGGAAATGGAGCCTTAGTCCCACCCCCGCGCCTTCTACCTCGCGAGACTTGGTG
GGCTCCTCCCTCTTTCTTTTCTGCCACCGCCATGGTAGGTGTTCTTCTCGTGGCCTCCGC
TTCCTTGTGGCGGCTGGGCGCTCTACCTCCCTGCCTTTCGGCTGCTTGCCCTGGTCTTAG
TGGGTCTCCATGGCTGCAAGTAGCCTGCGGGGCGGGATGGCTCACTTGGGTCTGGGGCGA
GGGACCTGGGGCCGCGTGTTCCGACCGGAGTTGGGTCGCCTTAGACGCGCGGGCCTGGGC
GTCTGAACGCGCTCCCGGTCTGTAACCTCAACCTTGCTGAATCCTTCAAAAGGCAAGTTC
TCATTTGCAGGCATAATCCGGGCAGGCAAGCCTTGCTGCTCGCTCTCCAACCTCCCCTTT
CCTTAGGCAGGCCTAACCATTTTGCTGTTTTTCCCATACAGCCATCCAGACTGAGGAAGA
CCCGGAAACTCCGGGGCCACGTGAGCCACGGCCACGGTCGCATCGGTAAGTGTGGGCCTT
CTAGGCGTTTGGCCTTTGAGTTGTGTTGGAAAGTAGACAACTGTAAGTCGAAGAAAACAT
TTCTGAGGCCTGGGCATAGCAGTTTCCCTACTTTATGTTGGTAGTGGGGGCGGAAGGCCG
AAAAGGTTTATCCCTGAGTCTTGATAACTCATGCTCAGAAACGGATTGTAAACTGAGAAC
AAACGAGAGCATGCGAGCAGGTAGAAGTCATTCATGTAGCTTTGTGTGCCTGCAGGTAAG
CACCGCAAGCACCCAGGAGGCCGCGGGAATGCTGGAGGCATGCATCACCACAGGATCAAC
TTTGACAAATAGTGAGTGTTTCGGAAGTGGGGGCAGAAGGGATGACTTAGAACAGCTTCT
CTCTGGAAACGGTTTCTTAACGTTGGTTATTAGCTTTAGCGAGCAAAACACTGCATGTGA
ACTGAGGGAACCTGTCCGAGGCTAGAGTCACGCTCAGGTATTGCTTGTTGCCTCAGTGTG
CTAGAGTCCTCGAAGAAAAACTACTGACCTTATTCACTGGCTGTGGACTTTATGGCGCAG
TCAGTCACCAGGTTAGTGACATACTTCAGATCAACCCTGTTTAGGGACCCTGTTAAAAGT
GAGGGCGGGGTTCTACTGAGTGGCCTGACAGCCAGTTAAAAATTATATCAGGTGCCTGCC
GTGTCAATGTTTACAATAGTGAACATTTATACTGCGATAGGAGATAGCTAGAAAGATGAG
CTTGCTCTGAAGATGGTTGCCTTCCTTCCTAGTCATCCAGGTTACTTCGGCAAAGTTGGC
ATGAGGCATTACCACTTGAAGAGGAACCAGAGCTTCTGCCCAACTGTCAACCTGGATAAA
TTATGGACGTTGGTCAGCGAGCAGACACGGGTCAATGCAGCAAAAAACAAGAATGGAGTT
GCTCCCATCATTGACGTTGTTCGATCAGTGAGTGAATTGGCTTGTCATTCTTAATGGGAC
CTTTAATATGCTATCTTGTTTGAAATTCAAGCCTATGTATATATTTGGCCATTACCTGTT
AGGAAATCCACATTTTAGTAGAATTGTTTCAGGTAATTGAATTGGTCACAATTAGAACTC
CTGTCCATTTGGTCCCACTTGTTAAGAATTCAGAAAACATGCCCACCACATATTTGTTTC
CATTTCTAACAGGTTTGCTTTTTTTTTTTTTTTGGAGCTGGGGACCGAACCCAGGGCCTT
GCGCTTGCTAGGCAAGCTCTCTACCACTGAGCTAAATCCCCAGCCCCTGCTTTTTTTTTT
AAATGAAGTTTATAGTTGGTCCGGAGTGGTCTTAAGACATACAGCTTGGCTTTTGCAGGT
TAAGTCTTTCGTTCTCTTATCTAAGGCACTATGTGTTTTAAGAGCCACCCTACACAAATA
CACTCTGCCTAAGTGCAGAGACCCAAACCAAAGGGAAGCTTTTAGGTAGTCATCATTCCT
AGCTTATAATTAATTTGTATTTAGTAGAGGTAGTAGCTGGTCAGGAGTGGGGAGTTAACG
TGCTTAATCGAGACTAGAGTCACATCCTGACATGGCACTTGTCCTGGTGTGCTAGAGTTC
TCGTAGAAAATCTGCTGGTCTTGATTCACTGGTAGGGGCTTTCAGTGACCCCATTAGTGC
TCAGATCAGAAACATAACCTACCTGGGGTGACACATGCTATATTCTCAAAACTGTGAAGT
TGGTGGGTCTGTGAGGCCATATTGATCTACATTTGAGTTAAAGGCCATCCTTTACATAGA
CTATCTGAAAAGGGGGAGTAAGTCAAGTCCTACTGAGTTTTGGGGTGTGGAGCGTCTGCT
ATAGTGTATTGTGATTCTTTTTCTATTGTAGGGCTACTACAAAGTTCTGGGGAAGGGGAA
GCTCCCTAAGCAACCTGTCATCGTGAAGGCCAAGTTCTTCAGCAGAAGAGCTGAAGAGAA
GATAAAGGGTGTGGGAGGTGCCTGTGTCCTGGTGGCTTAAAGCCACTTCAGAGGCTAATT
AAATGCAAACATTTTCCATGTGGTCTGAGTAGGTTCTTTGCATCCTTCCTTGTCTGCGCG
TTGAGAATCTCCCTGACAATAAGTACACTGTAGCTGTCTTCATGCACACCAGAAGAGGGC
ATCAGATCTCATTACAGATGGCTGTGAGCCACCATGTGGTTGCTGGGATTTGACCTCAGG
ACCTCTGGAAGAGCAGTCAGTGCTCTTAGCCATCTCTCCAGCCCCTCCTGAAAAATCTTA
AGTTATGGGAAAAACCTTGCCGTCCATATTAACATTTGCCTGACTTTGTAAGCTCACTAT
AGTGGACAGGTGGCTCAGGACTGGGCTACTTAGTACTGGACAGGTTAGCATGGAGAACGT
AGGGGAAGAGGTGTAGGCTCCATCCAGCTTCACTTGATGGCATCCAGGTGGTGTTCCTAG
GGAGCATGTCTACCTGCAACAGCACATCAGCACTGCAAACTGAGGATATTTTAGAATCAG
AGCTGTGCTCTTTGAACTATTGGGAAGATGAGGCTTTAAGAGGACCTTGGAATAAAAAAC
CAAGAACTTGATTGTCTACCTCTTTAAATCTGGAACATTATACCAACAAAGCTAAGTCTT
GAGTTTCTAAGGAGTAAAGGAGATTGTGTACACTTAGCACTGAGGCTCCTTTAGTAGCCA
AGTGCATATTACCAGGCAGTATAAGTTGGGAAGGGTCACTTGGCAGGGAAAAGGCTATCA
TGGCAGAAGCTTACCAGTAATGAACATGGGTTCATGGAAAAAACCCCTTTTAGATGTTAT
GACTCTAGAGACACAATACTGTATGCCACCCCTAGTACAACTAGGGGTCTAAATGTTATG
TGTATGGGGGTGATGTCTGGCAGGACAAATGTAGGATCTTTAACAAAAGTACATAGTTAA
ACAGGTTTTTATAACAAAACACTACTAAGTTTGACTTTGATGTCATGATAGCTGTTTGAG
ATGGATATGATGGGCTTGAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1064, 1315..1390, 1832..2006, 2911..3039
1001..1064, 1315..1390, 1832..2006, 2911..3036
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved