Rattus_norvegicus Locus Rps3
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rps3
Rattus_norvegicus
Rps3
1
SNORD15, SNORD15
1750..1897, 5460..5604
7363
gtagcttagatttatactattcaacagtctgtccctgaagccctggtggtttattactt
tgacaggtccctgctggtatcccaccctgtttcgagtccaaaacgttcataggtccgtgt
ggatgtgctcactaccagaaaccctacaaaaagcccatctcatggatcagggtttacctt
tgtaataaagatcgtaggattttaatattttaaaaaggatgtgtgtgtaagctggagaga
tggctcggtggttaagagcaccgactgctcttccagaggttctgagttcaattcccagca
accacatggtggctcacaaccacctgtaatgagatctgatgccctcttctggtgtgtgtg
aagacagtagtgtacttatatataataaatctaaaaaaaaattgaaaaaaaaagacgtgt
gtgtatgtatgcgcgcgcgcgcgtgtgtgttatgcttatatatacgaatatacgtccatg
gtttttgacagtctgtaacttactgtgccatcccctaaatacatttcaatgaaagttttc
attagtatagatgtgaaggaggctaaaatctgttatatttgttagtgtgtgcttatgctt
gtggtttgcatctctagtctcaaggtttttctgttctaagtttttttatttatttacata
tttatttttgagttggaagctcttacagcccaagctggcctcgaattcgctacatatagt
caatgatgactttaaacttgttgtgatcctctacctctttagtgctggaatcacaggtgt
gctccaccattctacgtaggtacattgatcattttcagaccagaattaaatatgcacttc
ccgttcggcccacactacaggttgctaggttacacttttttccttcctttacgactctgt
agacgcaaaacttcacttcccaggaacacttgcaagtgtgtccgtcgcgtagcgtcgcgt
cattgctcccgccctatatacctacttccgcccgcgagccaCTTCCTTTCCTTTCAGCGG
CGCGCGGCAGCAAGATGGCGGTGCAGATTTCCAAGAAGAGGAAGgtaagcgtctgggttc
tgtccgggaatccgccgcgtgttctaaaggtgcccgggaggcccatggctccgtggtcgg
tcctgaggagcggctgggccctcctgcggtctctgcgagccgcggatggccgtagattgt
gtgctgggccggagccgggcgagtgcagtgtgtctggggaagggaggcacaaactcgagt
tctggaccgacacgaataccgggcgtctccagttccggactagacagctttgagcgtttc
ttggtctgcataactagtgatcctgtggcacaattagagggcctgcgccatcagatctaa
tccagtttctttggtaagtgaagtttagcagtcccttgttctcttatccttgtcatcctg
caagtggccatagttgaaatcctattgacttggcttgttcactcgggacttgaagcagca
gcgtcccctggttttttcgttttttaaaatcattccatgggggaaaaatgcacaaattgt
caggtttagaagtagatggcctgtcgtgtttgtgcttatgcacactaatggtaaagctgt
tgtccacagtgttgtttggagttaggattcccaggtacaacttacacagccccagctgtg
cagaaagaactgtaaatgtgctacttggggacagagtttgtcttttgtgtgtagattatg
tggtaaagcccttcgatgaagaggtgatgacgagtctgactaggaggtatttgtctttgc
ccaggatgcctcactgcgctgcgttctgtggcacagttgtgagcactgtggtcaaagaaa
cttcctaaagatgaccaagaggcatttgtctgagaagggttgctgcactcctgcagggcc
attgggcttgctctggctaatgagaactcttagccctgtttaacttcagagttaacttgt
ttctttggtttagTTTGTAGCTGATGGCATCTTCAAAGCTGAACTGAATGAGTTTCTCAC
TCGGGAGCTGGCTGAAGATGGCTACTCTGGAGTTGAAGTCCGAGTTACGCCGACCAGAAC
AGAAATCATTATTTTAGCCACCAGgtaaaaataccattgactggttatcccctctaaata
ctgtgtgtattaagatgctatgtagaccagggccaacttaagtagtaaaccttgtcttgg
tgagtgtagctactttttaaaaattgcatttgaaaagatttccatttaatgtgtgtactg
atcttgtagtagatggcaggtgggattttgagtaaattataacttcctgtctacagAACA
CAGAATGTTCTTGGGGAGAAGGGTCGTCGGATCAGAGAGCTGACTGCAGTTGTCCAGAAG
CGGTTTGGCTTCCCTGAAGGCAGCGTAGAGgtgagttcccctgctttatttaccgggact
ttagactgaagatgtggcttctgctatagaatggtacttctgagaacctgacatagagct
caaacacaaagaaaacctgacatggccagtgaatacaggtggattggtgctctgccagtt
tccttaaaagcagagtgatcgccatgcgtggcagggccacatctttatcctggcacgcag
aaggcaggataagggcagtgcagagctagtcagggctgccctgtgagaccctgtcttaaa
tcagagacagtatgattaagtgtgtgggatattctggtgaagtattttacattccatttg
gatgcacaggtgggtttgctgtccttactgtgttgtggggagccaacatagaagggcaac
tcagctgccttctgtggggagtgggaatactttagtatctaagggatatcgcagtggctt
aactgaagattggtgagtgatggaaatgtactttttctttaaagCTGTATGCAGAAAAAG
TGGCCACAAGAGGTCTGTGTGCCATTGCCCAGGCAGAGTCTCTACGCTACAAACTCTTAG
GAGGGCTTGCAGTTCGAAGgtaagtgttctgagacttggtggccatgcccttctgtggat
cagtgtgtgtctgacatttttgttggcaaataacttcattgacagagtcatctttttgct
ggtgtaatagggtagtccatgggctggagagatggctcagtggttaagagcactgactcc
tcttccagaggtcctgagttcaattcctagcaaccacatggtggctcacaaccatctgca
acacaatctgatgttctcttctgctgtatctgaagagagtgacagggtactcacttatat
aaagtaaataaaatcttttaaaaaaaataagacaaattataaaaaaaaatagggtagtcc
atgcccccactgaaccactaggctaactagactggtaggctggtgacacatgtatctatg
ctaaagttggaagactttgatttgggaggaccagcctgggctacaggatagacccctaaa
gaatggtcagtgctatgatgagatgctgtgggtatgttgagaatgaaagaatatatagaa
tcctacagggagggacatctgctttgtgaggtttagtgaggaccctggatgggtgagcag
taacgcctccttcctttctgcctgtgagggaggacatctgagtgcagctttagtgcttcc
ggacagcacaggtttccaaacaagctagaagtcatgtgactctggtagtgcgcccacggt
gggaactataaagagccgttctgatgggaaagcctccaaacgagacagttatatcagtga
ttggctaggtgccattgcctacccttactcagtgctgagggtagaaagtcagcaactcaa
atagaggctagtctgggggggaagctttgtctcaaaaaacaaaacaacttttcctgtaag
ttgtataacactgaggaatgatgtaaagattgtctaagggttgggacccctgcctcaact
gtaaagttatgtttttaaaaattatacagtcaggttggagagatggctcagtggttaaga
gcacagactgctcttccagacatcctagttcaattcccagcaaccacatggtgactcaca
accatctgtaatgacatctggtgccctctcctatctgaagacagctacagtgtacttgta
tataatatatctttaaaaaatcgtacaatcttgctttggttataaggattagatgttgaa
aaggtcagtttgcttctttgtcattgagtcaggatttcactgtagtcctacatgatggcc
tccaaatcagagattgcctgctgaaatgtctgccactaccatacctcttggttccaacag
tattgtgtttctctgtatgaccctaggctaggctgcccttgaactcagatcctccttcct
ctgcctccctagtgctgggattaaaggtgtgggccgtcacccccagctttctagtgtttc
ataggctaaaggattttttggaggtggtggtgcactattagtgcttaatttgctggtggg
atggattctggaggcagaggaacatttccatgacctgcactgaggggcttttcgtgtgct
tcaaaattaaggtggtacctggttgcccactcctgccaagtgtggcatatggtattgcat
actcttaatccaggactccaagacaggctggtggatctctgcaagttccagaccagccag
gaccatgtagtgagacctcgtcttcaaaaaacctatcctgacagcctgagtttaggtctg
taagaagggaacatggctccatagttgtcttctggcctccgtgcactcacatcccgtgca
tactgcatggtaatagattaactaatacgagctgtggaaacatacctatgttggagcttg
gccagcgcagataactgacttggagaagaacctgggcatgggggtgtaaaaaaaaattta
gaggtgattctaatgtgcaggtcaaggctgaaagtcatgtggtcagtggactgctgtttt
ggtataacttgtggtttcttctgtctaccattggagagttattactgtgaaaaccaaacc
ggggtgggggattggtagacaggttgtgttcttggtaataacagatgaatcccttcttcc
aaagGGCCTGCTATGGTGTGCTTCGGTTCATTATGGAAAGTGGGGCCAAGGGCTGTGAGG
TTGTGGTCTCTGGGAAGCTCCGAGGACAGAGGGCCAAGTCCATGAAGTTTGTGGATGGTC
TGATGATTCACAGCGGAGACCCTGTTAACTACTATGTTGACACTGCTGTGCGCCATGTGC
TCCTCAGACAGGgtaagtagctgtgcacggaagggatccagggtagctaagaatgcctag
ggcagagattagcatttctataggctttccttcagttaacgctactatggaaggagttat
gtatggattggcttctggagcagggaaaagttgcattcttaagccgtagccttctgtgtc
cttcggtgatgacacgatgacgagtcagaaaggccacgtcttgctcttgggccctgtcag
tgccatgttctgtggtgctgtaagtgcgtcccttggcaaaagtgtcctgcatactgattg
atttagaggcatttgtctgagaagggaacagagctcagtgcttttgaatagatgctgctc
tccccgctgtcctcttgtgtggtgggagaaagcccagttcagtcctaaccctggtgtctt
ttagGCGTGCTGGGCATCAAAGTGAAGATCATGCTGCCCTGGGACCCAAGTGGTAAGATT
GGTCCCAAGAAGCCTCTGCCTGATCATGTGAGCATTGTGGAACCTAAAGATGAAATCTTG
CCCACCACCCCCATCTCAGAACAGAAGGGTGGGAAGCCAGAGCCACCCGCCATGCCTCAG
CCAGTGCCTACAGCATAACAGgtacgtctgcagagaccttcctgggccaaactttttact
ggtttttcctctgatgtttcagtgtgtaaatagggtatttttaacttaatgtgggagaat
gcaagttgggatgtggtatctgattgacccacaagtctgtcagtgggcaaacacccactt
acttcattgcctttgctcaagagtttccagctcctcttctgggcattctgcccttcagca
gccttataaaggtatcaggccttcatgctggtttctgttaaaggcaaactgagtgggagt
gtgtgcccatgtagtaaatgaaggtgctcagatgtgtttttcttaccattgtttatttta
tttggtttcagGGTCTTGGCAGCTGCATCTGGAGGCTGGATGTTGTCTTGTAAAGACGTT
TAATAAAATCTTGAACAAAGACACAAGGCCTGACTGGATTGTGTCCAGTGTTCAGCTGAC
TGTTatggtggcctgtggagcagtgcttgttctgttggtttaagctgtagggcttgagta
gagctgaccagagaagtcatgggtccatgaagttggctacagggcagcatcctgaccgtg
ttgaacaaccaagggttagaagaacagtttggtttggtgctcgtaatggaacccaggtcc
ttggacatagtacatatttataagtaagatggctatgtctccgacctggagtggtctttt
tttctaaaatgaaagaagatagctcagggtaaaaggtactttctttttttttttttttct
tttggagctggggaccgaacccagggccttgcgcttgttaggcaagcgctctaccactga
gctaaatccccaacccctaaaaggtactttctatgaaagcctgtgtactgtatatacact
attcattatacactaccctgcacgtagggagtaaattggcctctgttttgccgtgctata
ctgttttactctcagcaacccaaaataaaaagggaatttctgataccatttgagcttgga
agtttgagatgtaaaacctgttgttaggatccatatatttctaaattcgatacttggata
ttgttttggaaagttcagaaatctgtggcttctttgctgttatgtgttttgtgggaaatt
aatgttaatgtgggaatcctgtgttgtttgagagcattaatgaagctgtcaagggccagg
gtatagcctggctggtgcccaaaggcttcatgagccaccgatgctctttatttcattgtc
ttcaccagtgtagctctgcatggggtaagggcttaatttattcatgttgggtgcaccctg
actgtccacaacccatttttttttcttttttttcagagctggggaccgaacccagggcct
tgcgcctgctaggcaagcgctctaccactgagctaaatccccaactcctgtccacaaccc
attaaccaactcgtacagatgtgtcttttttagatttgtctata
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1063, 1993..2123, 2336..2429, 2924..3018, 5104..5291, 5704..5900, 6251..6363
1034..1063, 1993..2123, 2336..2429, 2924..3018, 5104..5291, 5704..5897
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved