Rattus_norvegicus Locus Rps16
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rps16
Rattus_norvegicus
Rps16
1
SNORA40
1809..1934
4946
ggccctgggttcggtccccagctccggaaaaaagacccaaaaaaaaaaaaaaaaaaaaa
caaaaaacaaaaaaacttactgctttccttagagaggacctgagtttggttacaggtaca
caagttgggtggctcagacaccctgtaactacatttccggggagcctggaggccttcctc
gggaacctgccctcacaaaagtattaaatctaaaaacaagactattaggaggattctgga
taaagatcttctaagataactgccctgcagacaggtcctgagggtaggttttctagggca
gggctaagctgggaagagcagtttcccaggttcgtttgctgggaagagccacaaagaggt
gaaggccttccagtggtgaaggcccgagactctgagggaaaaaaaaacgtatataagatg
caatccaggaagaaagagaagtttaggagagctttggaaagggcttttaagggggttagg
tttactgggaagaagagtctcggataggaaggcaattctggtgaaaggcagattcgcggt
ggaagatctgaagggctaggggaagagggttctgggaggcaggattctgaaaatccagcg
tgatttagcgaagtggaggcaggaagactgagatgggatggggaccctgggaaatagtga
aaggaagacggcgagttgggggagtgtgagaattggtccggaggagggctttgggagagt
atcgaagagcagaaatgtctataagaattggccaaaagtcaagaccaaagcggcggaaag
ataatggaaaaggaagcccagccctccattttccgagttaccgaccgagtccccgcccag
tcccacacagctctgcccctccccatcgaaggccaccccctcccttgcttgagggcgttc
ccgccgcatttcatacgtcctgacttcaacgttagccgtaaagctcgcttctgtcgtgac
tcaacgctctgtgcgcctgcgcagaccctggaaaatcggtcGGGGTGGCCCCAAGCTTTC
CTTTTCCGGTGGCGGCGCGGCGCGGTGAGGAGCTCGTGTTCATACTTGTAGCTATGCCGT
CCAAGGGTCCGCTGCAGTCCGTTCAAGTCTTCGGACGCAAGgtgtgccagagacgggatg
aaaaaagaccggtggggtggagtgggaaggcccgggctgggacacctcaggaacgggggc
ccacctgagaattagggtcccgaactcactcggccccgccatctccctcgcctttcgcag
AAAACAGCCACAGCTGTGGCCCACTGCAAACGAGGAAATGGGCTCATCAAGGTGAATGGA
CGTCCCCTGGAGATGATCGAGCCGCGCACGCTGCAGTACAAGgtgttggggtcggggacg
ggcgtctgggtggcggagagacggaaggaaaggccccgggactattagaagcagaggtgg
ggaagggagaatggcttgcctagcggtagatctagacctggacttgggaatggtgaagtc
cgagcaggtaacataaatggaaatgtggactattgaagattctgtaatcttcagtgtctc
gaagctcgccagattcgaggagccgatggccaagggaatagcacagtgtatctgacctga
ttgacgatttctgttctagaagtacaagtttacagactcatgtgtatgataacctagctc
cttggataatagcatactactagttacaagtctaacgtgcagtttgggtcaccatggagc
tacagtgtgaaacactgcaaagtaataaaaggtacaaacagtaggagccctctgaaattt
aacattgatagcacttgtatgggtttttgttgaaccagtggacaaagacttaacaatagg
tgcaagaacaaatcctcttttgcaacccagaactcattgttgtatgagtttttggtacat
gtaagaaggaatatcacggggttggggatttagctcagtggtagagcgcttacctaggaa
gcgcaaggccctgggtttggtccccagctccggaaaaaaaaagaaccaaaaaaaaaaaaa
aaaaagtctggaagtcgcccgttaggaggataatttccagagtttaataatgccactagg
agggttggggatttagctcagtggtagagcccttgcctagcaagcgcaaggccctgggtt
tggtccccagctctgaaaaaaagaaaaaaataatgccactaggagcctcctgcttagctc
taatccaagtcaggcaaaaggacatagttgggggctggagagatggctcagtggttaaga
gcactgactgctcttccagaggtcctgagttcaattcccagcacccacatggtttctcac
aaccatctgtaatgagatctggtgccctcttctggtgtgtctgaagacaactacaatgta
cttataataaatctattttttttttttaaaaaaggacatagttgggctgtctgaagtttt
tcgattctgtacaagacccttactggtgtcattcaggcagtcactagacttgctctccct
tgggtccactctgtaaaatggggactttttttgttctagtgggttatgtgagaacaaatc
tgaaagactggcttaaattctattactctcaaagggtaagaacctttgcagagtgaaaat
taccagatttattttgtattccatataccaaagatattttgtataacaaaataggtattt
tgttttttggtatcagtttatttgatttgtgtgaataccctgtgttgtgaattgccctaa
tggtcctgatggctccaggcctggcactcaatggagcctctggatagattggtcctagac
gctggacataatttgatccaaagtaatctggactaggatgtgtgctaatgaaggctcagg
ggaggatggagttggctgctgtgagaacagtggactgacttcctttttggggcacttcat
aatttcctgtcactccataatcacagctcccgaggtgtctggggttctcttctggtctcc
atggacacatacatggaaatcagaagggtacagggatcctaggataggttgcctccttga
ttctggtgatggtgggaaccacacaaggggagataaggaattcccacagagggtggttaa
gccaggctatgacttaactccttaacctgttggtttccatttctctagTTACTGGAGCCT
GTTCTGCTTCTGGGCAAGGAGAGATTTGCTGGTGTGGATATCCGGGTCCGTGTGAAGGGT
GGTGGTCATGTGGCCCAAATTTATGgtgagtgtgaggatctgggtgtgagcgtgagacag
ctcctgaagcaaggctgggtcttcacaaaactttttggtcattgtgtcttgcagCTATCC
GGCAGTCTATCTCAAAAGCTCTGGTGGCTTATTACCAAAAATgtgagtaagacctggtcc
atcatgatcatggtggttgggctatgcgtgggaatcaaggcttgggcacttaaatcttgt
cttatttctctctagATGTGGATGAAGCCTCTAAGAAGGAGATCAAAGATATCCTCATCC
AGTACGATCGGACCCTGCTTGTAGCTGACCCCCGTCGCTGCGAATCCAAGAAGTTTGGCG
GTCCCGGTGCCCGTGCCCGGTACCAGAAATCCTACCGATAAGCCAGTCTCAAGGATCAGG
GTTTACCTTTGTAATAAACATCCTGGGACTTTATATTTCTGTATTGTTGTCTCTCTTTGT
AGTGTTTGGTTAGACAATGCAAGAGATACCTTTAATAAGTGGCTGTGGGGACTGGAGTGA
TGGCTGCCTTCCCACAGCATTTGAGCTCTGACCTGGTTTCTCTCCCCCCAGCTATCCTGG
AACTCACTGTATAGACCAGGCTGGCCTTAAACCCAAGAGCTGTGCCTGCTTCTGCTTCAC
CAGTGCTAGGATTAAAGAGGTGTGGACTACCACATTCAGCGACTTAAcatttatttattt
tgtattttttcggagctggggaccgaacccagggccttgcgcttcctaggcaagcgctct
accactgagctaaatccccaaccccaggcatgtagttaagtatatggatgtgtgtaaatg
catgtggacgacagggcctccttggatgttcaagtgctgcccaacttactcttttttaag
gtttatgttacgagtttttgtaggtttatatgtgcactatatacccagttctcggcagag
gccagaagagggtgttgcatccctggaattggatttacagattggtaggagtcaccattt
agatgctgaacccaagttctctaggagagcagccagccagtacctgttaaacttgggagc
aagaccttggaaccatctctactagccccaagattcttaagaccacgagggaggcagaag
ggcaggtagaatgagctctcttactggatttgggtagtgagctgcagggatctgcctgtc
cccacctctcttgcacagggactacaagtgtgtgcaaccgtgcccagcgttaattcattc
tcttttgagacaggtttctgctgctctggctgtcctggaactccagaacaagctggcctc
aaagtcaaatatccacatccatctgcccaccaagggctgggattgaaggtgtcattgggc
ttgctccaactccaaggctgcttttctctcgtgtgcgtgcgcgcacatgttccctctttt
tggacattgctttctgcaccctccttggggtgttcgcaccctgtgtgattctccccagag
cctataactatgacaagtgggtggtgataggactgttcccaattttcctaaccctaaccc
tggtcctcacgcttcccaaagcaagcactttgccaatcaagctttcaccctatccccttt
tggttttgagcaatctggttatgttctgctgggccagagcaatcctatgtccccacctcc
atagccaggactagtgtgtgcaactat
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1120, 1260..1361, 3168..3264, 3354..3401, 3495..3946
1073..1120, 1260..1361, 3168..3264, 3354..3401, 3495..3640
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved