Rattus_norvegicus Locus Rps12
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rps12
Rattus_norvegicus
Rps12
1
SNORD101, SNORD100, SNORA33
1704..1777, 2416..2490, 2750..2876
4157
gacactggccgaaaacacgcccggagaaactagccacctatcaaatacttttttgaatt
gctgggttaaggaaggaagcccgaggctttaaaggtgaaactcaaacgtttattagcaat
ctaaaaaggaacttcatcaactttctgaaatcctcatgaaattcatgagcccgacaatga
tcgccgtatctaccgcgttggccatcggaagggaagcccgggctggctacggggatatct
tctgagagagacgttgtcttgtgtatttgctctggaagtagaagagtgagtgattccttt
aaaattaaaatgcatttgtcagcgtaggagggaactggctttaaggttctggaattccac
tcctggtggccaagtcctgggttgaatgtgcgagcttcaaagccaggctttccccttagt
gatagaccctcggagagtttaacatgtactgtacctcggggatcccagtttctgcgaagc
tgcgactcggggaataaaatagggtaaaaccgaaatgttcattcagaaccggttgcattc
agaaccaggatctgacctggctggaaagtctgcttaaacacattgcaaagcagtgggttt
gcgatcatagacaaatcacaaccactcggagcggctcaaaacaaagggaccaaaatgtgt
cctccggtaacgctcagcctaatcgaccagtgttaccaacaggcaacttgacagtaagat
atggagagaccacttaaaacaaacttattttgtaatgcagcggaaagaaaaaaaaaaaac
ggcagtacgttggctcctctcgcgtcccatagaagcagatcgtggggcctccgcgagcca
cgcccccaggaaggaggctgcccgttgtaatgcctgctggaaatccagacgcgttcttac
cacggacgctcctgaaggcggaagtggaaactcctaaggcccggcatcgcgggagccacc
tctctagtgggaggagtcgcacatgcgcacagaagcccagcAGAGCGCTTAAATACCGTC
ATGCGGCCACCAGCGGCCTTTTCCCCTGCCGCCGCCAAGTTCCGCGGAGGCGGAAGCTCG
GGgtgagtccgaactaaacctgtacgccgcataccgcgtgttctgtgcgctttggtttca
aatgtggagaagtgcttgtgttctaacaggcaatttactggcgttttgtcttatagTGCG
TTCAAGATTCGGCGTCACCCGTAATCCACCGCCATGGCCGAGGAAGGgtgagcggatggg
ccctagttggggcgtgggcctcccgcggaggacgcgggtctgcacgttatccaaattagt
tattgcccatggcctctcgaggattctaacgattctgtctgcatttcagCATAGCTGCTG
GAGGTGTAATGGACGTCAACACTGCTCTACAAGAGGTGCTGAAGACCGCCCTCATCCACG
ATGGCCTAGCACGTGGCATACGCGAAGCTGCCAAAGCCTTAGACAAgtacgtgtctcagt
ctcaatactgtggggtgttgcagccggaacaaaaactgcagccaagggacgaaagcgtga
agttcatgctgttagcacaaaagttctgagtgtcatccgtccagcaggaaacataggaaa
aggtatcaactctagcccacttaggatgtgtgggttgctgtgtggatcggggctgagcgg
tagttgcttttgttaagctacagtgtttgagtgatgacttgtattgtcggataccccttc
accccgttcatgggtgagattcagctagtctgacaaacctgtagcacttgggtacttttg
caaaaagaaaaagggaacgtcgttgacatctgtagtttacagatacaacttagcaatgtt
tcagtgtcttatttgggaatatgccttgtttttattatgtctatgcacgaggatgtcagg
tgattttaacatttgaatttcctgtaagctgacttgaatccaggtgggcatcgcagctcc
tgttgtgattatttacaatgtttgaataatgcagcattgaatcaactttcaaggtttggc
cataagcaggcttcctcaagaaataatggcctatgttatccaagggccaaggtttggaca
ggaaaattgtatgcatgcgctccagcagtttgcacactagtgtgtgctgcatagtaagcc
ttactagcatggtgagatgccttgactggaaatacttgaggccgtggtttcactttctga
ttttgcattgtagGCGCCAAGCCCATCTCTGCGTGCTTGCATCCAACTGTGATGAGCCCA
TGTATGTCAAGCTGGTGGAGGCGCTCTGTGCCGAGCACCAGATCAACCTGATAAAGgtaa
gcagacgctcttcctgtcctagtgattaacaggcaccagaactaggagctgtctggtgac
cttgtgacaatccggggctgcacatgatgacaactggctccctctactgagtcgcagtga
ggaaactgccatgtcacccttctgacgctgccaccttgggaattttgagtttcagtgtgt
actacctttattctctgctagtaattgcttttgtctttggtagGTTGATGACAACAAGAA
ACTAGGGGAATGGGTAGGCCTCTGTAAAATCGATCGAGAGGGGAAGCCACGGAAAGTGGT
TGGTTGCAGTTGCGTTGTAGTTAAGgtaagttctatcttttaaatgttgatggcctttta
atggaaacaagtctggaaacagacttaattatgctgtaagggtaatctgaaagccagcca
gctagtctgcttagctctgtgtttctgcagaaatgtaaaaaggctggcaatagtaacgcc
atgttacgagccttaaggacagttaagtttttaaggtccctgaaaatggctacagtgtta
attctggggagcactttaagaatgaatcaaatagttaataagaacttaatactgggggtg
ggggatttagctcagagcgcttacctagtgagctcaaggccctgggttcgggccccagct
ccgaaaaaaagaaaagaaagaaaaggaagaacttaatactggaaaagtaatttgcatcta
atttttttaagGACTATGGCAAAGAATCTCAGGCCAAGGATGTCATCGAGGAGTACTTCA
AATGCAAGAAATGAATAAATAAAATTTTGGCTCATTTTtttctccttgtttctttttgtt
tgctgctataaaatggaatgtccttgtttgggtggttggttgcagtttggaagtgtatac
tctgaaggttttaattggctaagcaactctaaccaggctacatacataaaactaaaatga
gaagagttcttttgatggacaaggaggtgcatcagctttaaaacaggcctcagaatctgg
cacaatttgggcagccggaactattgctttaggctctgactacatatgacaagttaagag
gtaaattttactgagtaaacatccaggttggtattaatgaaacaaaaatgtcaaatttag
gggagggtgaagggttaaattaaggtgaaattttggactcaggctccctgggggaagatg
taaacatgcctttgaagcttggatttctgaaccctggtattccaagtcaggtttttctag
cgttacagtaggttgtgctgcagattgcttagagagtaatgaaggattcttaatctgcat
tctgggacagttccctttatgtgaaccttcagtattttgttaagcactttagtgggttaa
aaaaacctgtggtaattttgcttttaaagtatctagttttaggaaatgtgccaaggaaaa
ctttcactgctcaagtcacttgacttgaaggacatttgatcagaaactgtttaaagaact
agaccagctactataattgtgtgctaacatgggttgaaagcaattgcagtcagaacttgg
gaggttctggtgtttttcaggtatcaagctcaggtcagacttgatcttcacctgctaggc
catttcagtgatctacctctaacttggtgggtgagaatacctgagatggtgtgtgaagtc
tgcctgagaatgggctggaactgtactggcctgccatggacaatgcaagttctccaggta
gagaggaatttgacttttacaaatagcgaaatctcatttcccctagtcctaatcaaaaga
atggctctaatcagatcc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1081, 1196..1246, 1369..1485, 2233..2335, 2563..2664, 3071..3157
1233..1246, 1369..1485, 2233..2335, 2563..2664, 3071..3133
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved