Rattus_norvegicus Locus Psmc5
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Psmc5
Rattus_norvegicus
Psmc5
10
SNORA51
3465..3590
7935
AAAATTTAGGAGAGACACATGCTATGGAATATTTAATCTGAATTGTATAATCGGATTTC
CATCCTCCCCCAAAGCAACTCAAAGCCAGCCAGTGCAAGGGACGTATCATCACAAGCAGT
CCCTGCCAACCAAATATTACCATCCTCCAGGTGCAGCACACAGGTCCAGCAAGGCCCGGG
CTTTCTGAAGGAACTGAAAGCGGCGATTGAGCTGGATCAGTTTGAAGGCAGAACGCGAAC
GATAACCTAGACCGTAGGGAGTGGATGTATAAAACAATAACGTCTACGGATGCCTTTTCT
AAGAGGACTTCCACAGCCTCACAACCCCATCACCCTCCCCCTAAGGAAAAGGAACACAAT
ATTAGAAAAAGCGTAAAGGCTGATATGTTATTCACGCAGCGCAAACCCACTCACCGGTCT
CCTTGGCCAAGTGATAGAACTTGTCCCGCCGGCTCTTGCCTACTTTGCCTTTCTTGCCCA
TGGCGGGATGGGGTAGTATCACTCACTCTGGGGAGAAAGAAAAAGTTGAGAATATCTTTC
AGAGCGCTGGATTTTTGCTTCGGTTCCTCGGGTGGCGAAGCAATCACTTACCGAGACGTT
AGATAGCCCTTAACTCCGCAGGTTTTCAACACTTAGGGAAGTAGCACATGTGGGTAGTGA
TCGTACTTCCGCTTCCGCTCGCGCTCCCTGTGTTCCTAGCGTCTTGATTTACGCCATTTT
GAGTGTGGCCAAAAATTTTGTCAGCGTGTCTTGCAAGTTAAAAGTAGAGGCTAGGAAGTA
GAGTACAATAACTACTCCCTAGACTCTAGGAAGCATCCGCCATAAGTTATATATCTCTTT
ACAAACCTACTAACCGCCAGTAGAGCCTGTAATAAAGCCACTGTTATTGTCTCACCACAC
ACCCCGCCCATTGACCCGGAACTGTTCTCGGTCGTGACCCAGGTCGCACGCTTTCGGCTC
CGCGCCTGCGCAATAGGGTGACTTGGATGCCGGCGGTCCCTGCCGAAGGAGGGAAGATGG
CGCTTGATGGGCCAGAGCAGGTAAGGATTCTGCCGCGGCGTCAGGGCGGCATCCAAGCCG
AGTGTGGAGTGCACAAAATCTGAACTGAGGGGTGGCCACTAGCAAAAGGGTCGAGTGGAT
CAGGGGTGGGTGGACCACGTCAGACTTGACCCTGCCTGGAACTGGATCTGCTGTGTCAGC
GCCACCCGCGGTAAGCAGGACAGGGCTGGGTAAAAACTGAATGAAGAGCTAGGCAAGCCG
GAATGGCCTGGGTGGGACCTGGACTTGGTCCTTCTGTTCTGCCTTTGTCTGTAGTAGTTA
CACCTTGGGTTTGTATAGCTCTTGCCACAGAGCAAAGCGCTCTGTAAGTATATGGCCCCT
TGAGCCTCCTAAAAGTCTTCGAAGGTAGGCGGTAATTGCATCCTTTTAGTGGATTCAAAA
GTGAAGGATTAGAACCAATAACTAAGCCTTTGCAGTTCAAACACACAGACCTCACCTATG
GAGATAACCAGTTTCTGAGGAAAAGGGAATGATACTTTCCTGGCCTTGTTTCTTAAGCTA
TATGGTAAAGTGCCCTGAAAATACTTTGGCTTTATCCCTTAGTAGTTTACGTAACTGTTT
AACAATTACACTTGTCTTCAGATGGAACTGGAAGAGGGGAAGGCAGGCAGTGGACTCCGT
CAATATTATCTGTCCAAGATTGAAGAACTCCAGGTAAGTCCAGACACCAGAGGGAGCTTG
AGAGCTAGCTGGTAGGTGCAGATTTCTCAACGTCCTTTTTCCACTGGGAGTGCAGCAAAG
TGTTCTTTTCCAGTGTCGTTCTTGTAGCTCTTCAGTTGTTAATTTATTATGCATATGTGT
ATATGTGTGCTTTCGTAAGCTTATATGCATCATATGTATGCAGGTGCCTGCGCAGGGCAG
AAGAGGGCAGTGGATCCCCTGAAACTTGAGTTACAGATAGTTATCTTTCCCAGGCACTTA
GAGTGACAACTAAACCCAGGCCCTCTGCAAAAGCAGTAAACCCTGTTAACTGGTGAGCCG
CCTCTCCAGCCCCTCCTCTGTGGTTAGGAAGTAACAAGCAGTGTAACGTATATTGGTAAT
CTCTTGGATGGGAATGGTATTTAGTTAGGATTTCTGTTTGCTCGCTCGCTCGCTTTTTCA
GGCTTTTCATTTTATGTTGTGTTTGGGTGTTTTGCTTGCATCTATGTCTGTGCCAGAAGA
TGGTGTAGGAGCCCTGGAAACGGAGTCACGGAAGGTTGTGAGCTGCCGTGTGGGTGCTGG
GAATCCAGCCCAGGTTCTCCCGGAGCAGCTGGGACTCTCAACCACTTTTAACCATGCTTT
AATGCTTCTGCTTTGGTCTTTAGTGCTTCACCTTTCTCGGGTCTGAAATAAGGCGGAAGG
ATGGATGTTGTTGTCTGTCTTTTATTGTCTTGCCTTTGTCTTACTTTTGTTTATTTAATA
GATTCTCATTGTGTAGCCCAGATGGGCTGGGATTCTCCAGCTCTCAGCCTCCTTAGGGTA
GAAATTACAAGCCTGTGTCGTCGTGCCTACCTTTTAAAACTAACTGTTTTTTCTAATTTT
ATGTTTTGAAATCCTTATCACCACCACCCCTTCTATGGGTGTTCCTAAATACACAGACAC
GACCTGTTCAGTCTGTATAATGTTACCTGCATGTATGTGCTCACTGGGTACTGCATAACC
ACCCCTTCTATGGGTGTTCCTAAATACACAGACATGACCTGTTCAGTCTGTATAATGTTA
CCTGCATGTATGTGCTCACTGGGTACTGCATAACCAAACGGGGCGCTTCTTCCTTGTCTT
CCTCTCAGCTTTCCTCAGGAGCCATAATTCTTTGTCTGGGGTTGAGGCCCCATGAGTGAA
CTTCTCCCTTCCATGTTAGCGTGTCCATTGGTGTCACCAGTGTTCAGGACTTGTCTAATT
TAAGAATCCATGTCGATGAGACTTCATGAGTGTAGCATTTCTGACTCTTTTTTTTTTTTT
TAAGATTTACTTATTTTATATATGTGAGTACACTGTAGCTGTCTTCAGACACACCAGCAG
AGGGCACCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGGTGCTGGGAATTGAAC
TCGGGACCTCTGGAAGAGCAGTCGGTGCTCTTAACCGCTGAGCCATCTCTTCAGCCCAAT
CTCTGACATTTCTAAGAAACAGTCTCCCAGCAAACCTTGTTTATCTGGCTCTTAGGATCT
TTCTGCCCCCTCTTCCAAAATGACCTCTGAGCCCTGGGTTTAGGAGTTGCACTGTAGATG
TCAGTTGGGACCAGCAATGCAGTCTCTTGACTTCTACGTTTTGGTCAGTTGTGGTTGTCT
GTAATTGTCTCCATTTGTTGCCAAGAGAAGTTTCAAGAGAAGGGACTAGAACCGCATTTA
TCTGTAATAGACTGCAGTTACAGATTATGCAGACTTAGTAAAGTGGGCCTCCTTGTGCTT
ACCACAGGCTGTGTTCCTACACTGACTGTATGGAAACAGAGTAAACCTACCCTGTGTACT
CCTCAGCCTAGGCCACCGTGCCTGGTCTGTATTGTGAATGGGGAAAAAAAGGTTTAGTAA
AGTGATTGTAGGCTCTTCACAATCCATAACGTAACGAGCCCGGCATAGTTGACTATGTGT
CTAGTACCGGGCTTTGTTTTCCTCCCTTTAAGCAGGCTGCAGTCCAGTTAGAGAACTGTT
GGGTGCCACCATGGTAATTGTGGGTCATAAGCATCACAGCTGAGTAGAACTATCAGTTGG
TTCCTCCTTGGAAGCTTGTGTGGCACCTTTGGCGACGAAACTGTGCTTTACTGCAGGAAG
GAGGCAGGGAGGGGAGGGACCAAGGCTATGGGAATGTCCTATGTTTTAGGAGTCCCTTGG
GTGACTGACCAACAACTCAAAAGGTGGCTTCTCAGACCTGCTGGGGTTTTATTAACTAGT
CTTGAATGGGGCTTTATCAATCCGGCTGGGAACGTTGCATTTGACTCTGCATATCCACAG
CTTACATGCATTGTGTATTGTGTAGACAATAAGACCTCGACGACTTTTTCAAACATCCTG
TTTCACCCAGTTCTTTCCTCCCAGGTTTGTCTTCTTCCCGCGCTCTCTAATTAAAGTTCC
TTCCACTCTCGTTTTCCCCTACGAATCACTTAACCCCTCTTACACACATTCACACACGCA
CTTTCCTGTTTCTGCAGTCACTCCAGGCTATACACACATCGGAAGAAGACATGGAACTAG
GAATTGACTTACTTTGATCTCACAGCAATTGGCTAGAACTCAAGCGTCTCACCTCAGGAC
CTGTCCACCATACCATGTTACCTCTCCAGAAGCCACTCCCATGAACAAACTGTAGATAGT
TTCTCTCCATTAGATTTTGTTCTCCCTGGACCAGTAGTGGCGGGCCTTCTGTGATACCTG
CTTGGGGCTCGTTAGGAAATCTTAAAGAGGTCAGGACAGGGCCCTCAGATACTGCTGGAG
AAGCTGAAGGAGCAACTTAAACTGCCTGTAAGAATCTCAGCCGAGATCGTTTCCTGCAGG
CTTTGACTGAGTAACGGGATTTGTCTCCTGTCTCCATAGTTGATTGTGAATGACAAGAGT
CAGAACCTCCGGAGACTGCAGGCCCAGAGGAATGAGCTCAATGCAAAAGGTGAGGGAGAA
GATGGAAGACTCCCTGTCGGTCTGCGGCAGGCTCTGGGCGTGCACTGCTCGGTCCTCAGC
CCACAGTGATGCGCACTGTCCGGTTATGTGGCTGTTCCATGCACACCTTATCTAAGCCCT
GGTGGAAGCCCCTTTCAAGTCTCAAGTCTTAAGTTCTTTGTTCCCTTCCAAGTGTTAATG
GTCCTTAGGTGACTGATGTTTTTTAATGGTTTGGGGATTGTTGTTGTTGTTGTTGTTAGT
TCGTCTGTTGCGGGAGGAACTGCAGCTGCTGCAGGAACAGGGCTCCTACGTTGGAGAAGT
CGTGAGGGCCATGGATAAGAAAAAAGTGTTGGTCAAGGTAAAAGCAGCGTGACCCCTAGA
GCCGGCTCCTGGCACTCCCTCCCTTTGTATGTAGCCTGAGTGTCCGATTACCCCAGAGCT
TCCTTGTGTTAATCGTGGTTGGGATGGCTGTTTTGACAACTGAGGAAAATCACAAGCCCC
CATTTCTTCTTCAGGTCCATCCTGAGGGCAAATTTGTTGTTGATGTGGACAAGAACATTG
ATATCAATGATGTGAGTGTGGCAGGTAATATTGTGGGCGGGGGAGCAGCACCACCACCCT
ACATCCTGAGACTCCCTCCCCTCCCTCCAGGTGACACCCAATTGTCGGGTGGCTCTAAGA
AATGACAGCTACACTCTGCATAAGATCCTGCCTAACAAAGTGGACCCTTTGGTATCACTA
ATGATGGTGGAAAAGGTGCCAGACTCAACCTACGAGATGATTGGCGGGCTAGACAAGCAG
ATCAAGGAGATCAAAGAAGTGATTGAGCTGCCTGTGAAGCACCCTGAGCTCTTTGAAGCC
CTGGGCATTGCACAGCCAAAGGTAACATCAGACTTAGCCAGCACTGGGTAGCCTTCCCCG
CTCAACAGCAGCAAGAGAGATTTCTGGAGCAGTAAGCTAGTTTGGATACACAGTCCAGAA
AAGATACTGGCCTTCAGTTTTTATATTCCTCACCTCAAGCAAGGGATCCAATACAAAGCC
CTCACAGAGCTGGCCTTTTTCCTAAGTGTAATGCATACTCTCCCTCTAGGGAGTCCTGCT
ATATGGACCCCCAGGCACTGGGAAGACGTTGTTGGCCCGGGCTGTGGCTCATCATACGGA
CTGTACCTTTATTCGTGTCTCTGGCTCTGAACTGGTACAGAAATTCATTGGGGAAGGTGA
CTATGGCTACAGGTGTGAGGGGTAAGAGGAAGGGTAGCGGGTGGGGTGTGCATGGCTCTA
ACGTCGGCCTTGCACAGGGGCAAGAATGGTGAGGGAGCTGTTTGTCATGGCCCGAGAACA
TGCTCCCTCCATCATCTTCATGGACGAGATCGACTCTATCGGTTCTTCACGGCTGGAGGG
AGGCTCTGGAGGCGACAGTGAGGTACAGCGCACAATGCTGGAACTGCTCAACCAGCTGGA
TGGCTTTGAGGCCACTAAGAATATCAAGGTGAGATGGGATAAGCTTTCACAAGCCAGCTA
ACAGGGTGAGGCGGCATGCCGGCCTGAGAGAGTGTAGCTGATTCCTCTCCTCCTTTCCCC
AGGTTATCATGGCTACTAATAGGATTGATATCCTGGACTCTGCCCTGCTTCGTCCTGGGA
GGATTGACAGGAAAATTGAATTCCCACCTCCCAATGAGGAGGTCTGTGCTGGAGGTGCCT
GGAGGAGCCCTGGCTGTGGAGACAGAGCAGGGCTTACGGCTTTCTTTCTTCTCTTGTCCC
TAGGCCCGGCTGGACATTTTGAAAATCCACTCTCGGAAAATGAACTTGACCAGGGGGATC
AACCTGAGGAAAATTGCTGAGTTGATGCCAGGAGCTTCAGGGGCTGAAGTGAAGGTAATT
GGAGGCTTCAGGGAAACAGGGCAGTAGCAGGAAGCCCTAAGAGCCAACTCAGTCCTAAGG
GGGTCAGCAGCAAGGCCTCAGCTTCTCTCCCTACCCAGGGCGTGTGCACAGAGGCCGGCA
TGTATGCTCTGCGGGAACGGCGTGTCCACGTTACTCAGGAGGACTTTGAGATGGCAGTAG
CCAAGGTAAGTGCCTCACTTGTCTGCCTTTGCTGTGGTGGCTCTGGAGCAGGGGTTGCAT
AAATCCCTGCTCACACATGTACACGGGATCTCTTCTCCTTCCCTCTCCAGGTCATGCAAA
AGGATAGTGAGAAAAACATGTCCATCAAGAAGCTTTGGAAGTGAGGGTGTGTCCTTTGTG
TGGATCCCTCAAATAAAGGTCTGTGCGATAAACTCCAGAGCTCCAGTTTGTTAGTACGTG
ATTGCATTGTTCAATGACCAGGTCTGGGCACCACCAATAAACAAAAAGATTTATTTGGAA
TTTTCCAAGTTTGCCAGAAGTGGCATTTGCCAAGCCTTAGGCCCACCCTCTTTAAGACCA
ACTGCAAAAGGTAACAACAGATCTCCAGCTTTCCCCTTCCCCTGCAGAGTGCACGCACAC
ACGTACGCCCCTTCTTTAGCTGGGTTAGAGAGCTGGCACATTCCCACCCTCAGGAGGTTC
CACCTCCCCCTGCTCAATCAGCTATGGGTGGGCAGCCCCATGGCATCCAGGAGATGATGG
CGGCTGCAGCCGCTTGCATAGATTAAGAAAAGAAAATAAGGAAGGAGGCACCAAGTGGGC
TCCCTGAAAAACCCCGTTACCTCTGTACAAAAAAGTGGCTCCCACATAGAAAAACCTGCT
CCCCAAATAGTGCAAATACCCAAAGAGAAGGACAACCAGCAGCAAGGCTGGGCTTGTAGG
AATGGCAAAGAACTTTGGTTGAGAAAGGCCAGGAAGAGTCTGGGCTGGGCCTCCTCTTCC
TTGCCCAGCTCCCCAAAGCCAGCTCTGACACTGGCCCTAGGGTGGAGCCTGTAAACATGC
AAACCCAGCAGCCTTTGGTTCGGAAATGTCTGTTACAAAGTTAAAAGCACAGCCTCCAGC
AGTCCTACCTGGGCCTGCCTGCAGGGGGCTGAGGCAGCACGTTGCAAACCTAATTAAAGC
CAGTGCTAAAAGGTAAGTAATAAGGCTTTGGGGACCAAGCAGTGAGGACTCTAAAACTAC
ACTTATGAAACTAAAGCTGGGGAGTAGAGGGTGACAGGAGATACACCTCACTCCATCCTG
TATGTCTGCAGCCCCAGCCATGACCACGAGGTGGTCTCCTGCCAGGTTCCAGGGCAGGGA
AGGAAGGAAGCAATCCCTGAGCAGTTAGGTCAGGCGAATTCCCAGCACCTGTTCCAGTTC
CTGCCTTCGCTGCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1039, 1641..1712, 4599..4668, 4919..5016, 5174..5230, 5310..5540, 5749..5875, 5957..6147, 6242..6340, 6423..6533, 6638..6724, 6830..6935
1016..1039, 1641..1712, 4599..4668, 4919..5016, 5174..5230, 5310..5540, 5749..5875, 5957..6147, 6242..6340, 6423..6533, 6638..6724, 6830..6880
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved