Rattus_norvegicus Locus LOC686564
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus LOC686564
Rattus_norvegicus
LOC686564
10
SNORD42, SNORD42
1428..1496, 3228..3290
4653
TGGCTATCAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAGAGCAGT
CAGTGCTCTTAACCACTGAGCCATCTCCCAGCCCATTGTTTTGCTTTTTAAAACAGGGTT
TCTCTATGTAGCTCTGGCTATCCTGGAACTTGCTATGTAGACCAGCCTGGGCTTGAAATG
CTGGGAATAAAGGTGTGTACAGTTCACATTTGACTTAAAAATCCCTTATGTTTGTGTGCA
GGTATGTGCACATAACTAGAGGTGTCCATAGAGGTATGGCTGCTGGGAATCCAACACAGG
TCCTCTGAAAGAGAAGTACATGATCTTAAGTGCTGAGCATCTGTCCAACCCCTGAAATTG
TATTCTTTCCAGTTGGTAGTTTTATTGGCTTCTGACACCACAAACCTCTTCCCTAAGGCT
GGAAATTGCTCAAGAAGTGAAGTGGTAAGGACCATAAGCAACCATCAGTGCTAAACCCAC
TGTTTTAGACCTAGGGATATTGTTATCTTTTAAAAACTACCATTCAGGCCATGTGGTGTT
GGCACAGGCCTTTAATCCAAGCACTCAGGAGGCAGACAGAGGTAGGTGGGTCCTTGGTGA
GGATCAGCCTACTCTACAAAGTAAGTTCCAGGACAGCCAGAACTGTTACAAAGAGAAACC
CTGTCTCAAAAAGAACAGCAATTCAAAACAAAACAAAACAAAACAAAAACAGAAAACAAA
ACCTACAATTCTCCAGAAAAATCCTGTGTCAGTAAACCAAATTAAACCAAAACAAAAAAA
CAAAAACAAAAACAAAAAACTACAACTCCCAAGAAGCATTAGGGCCTTTCGAAGGGAAAG
GTGGCGCATGCTTCATCTACGACCCTAGGAAATTAAATGGAACTGCAATTCCCAGGAAGC
CCCATACTGCTGATCATCCAATCAGCGGTATGTATAAGCTATCGCGAGACTTTCAAAAAA
ACTTCATTCTATAAGCTCATGGGAATGAGGCTGGGTAACCCTTTTCGCCAAGATGGCGCC
GAAAGCGAAGAAGGAAGGTATGTTGCGGTATGGGAATGTGTCAGCTCGGCCTGGGATACC
CGCAGAGCGGACTCACGGGGAAGATTACTGCTCGGCTAAGTCATGGGGTGTTTGTTCTGT
AGTTACTGTCACGATTTAGGCCCCACTGCAGTGTGTGAGGATCGCGTGGCCCAAGCCGCA
TGGGCTGGTCCCGTGAAGGGTATTGCAAGTCAACGCGGCTGGCATCGCCCGCCACCGATA
GCCAAGCTTTTGACTTTCGGGAGCTACTTAACATCCACGGAGTGGCGCACCGTGTCCCAA
AACTATAAGGGATTAAGAGTAGTCCTTATTTGCCCTTTTCCGCGTTAAATGGGGTTATAC
GCACCAACGCGATGTTACAACGGGTTAATTATCTTTGCCTGTGGTATCGTGCATATGATG
GAAAAAATTTGAAGTCTCCTGAGACCTGTGATGTCTTCAAAGGAACCACTGATGCACGTT
TGACAATGCCGCCGGAAGGGATCACTTTATGAATGCCACACGCTGTAATTTTTAATGTCC
TTTCCCAGCTCCTGCCCCTCCCAAAGCCGAAGCCAAAGCGAAGGCCTTGAAAGCTAAGAA
GGCAGTGCTGAAAGGTGTCCACAGTCACAAAAAGAAGAAGATCCGAACGTCACCCACTTT
CCGGCGGCCCAAGACCCTGCGGCTCCGGAGGCAGCCAAAATATCCTCGAAAGAGTGCACC
CAGGAGAAACAAGTCAGTAAGGACCCTGTACCCACCCAATGGCTTCCCTTATAAAACAGT
TGTTCAAGGAGTTACTCTGGTGTAGGTGTGAAGTCTTTTTAAAGTTAACTACATGTAAAA
ATATTTGAAAGTTGACTATGAAGAGATCTTGGTTCCAAGTGTAATGGCACTTGTTGGAAC
ACATTGGGAGTGTTGATTGATTGGTGTGGGATGATTAAGTTGTCACATTGGGGAGTCATG
TCCTGGGAATGGTGTGGAATCTTGGGGAAAAAAGATTTATTTATTTTATGTATGTGAGTA
CTGTAGTTCTCTTCAGACATACCAGAAGAGGGCATCTGATCCCATTACAGAGGGTTGTAA
GCCACCATGTGGTTTTTGGAATTGAACTCAGGACCTCTGGTAGTCAGTGCTCTTAACCAC
AGAGCCATCTCTCCAGCCCTGAAACACTTTAATTGACCAAATTCTAACACCACTCAGAAG
TTTGGTAGAATGTGCCTGCTGAAAAAGTGTTGTGCATATGGGAAAAGTACTTGCCAGACA
CTTCATTTCCTATTTGTACCTAGAATCTTGAGTCATCAGTTAGCTTCAAAATGGAAAGCA
GTTGCATAAGTAAAGCTTGGCTTTTCAGGATGTCAAGGAAAAGTTGTCTCCCAACTGCTC
AAAGCCAATTTTAGAGTTGCTGTTGGATCTTTTTGTGGCTTTGGACGGACGCCTTTTCAG
CACAGCCTCAAGCCTTACATCAGTCGTATTTGGTGGTTATCCTGTAATGCTGGGATATCA
AGGCTAGAGGATCCGATCCGAACTCCAAGGTCATGGGACCTTGTCTCAGTCCAGAAGGGT
AGGTGTAAGAAAGTGGCTCTTGGATTTAAGGCCAGCTTGTGTTCCATCCTGAGACCCTGT
CTCGAGGAATAGTTGCCAAGTGTAGCCAACCTCTAGCAAGTGAGCATAGTTTTCTCTTTT
TATTTGATCTGGTCTCAGTAAATAGGAAATGTGGAACTCCGATGGATAAATGCATAAGTT
AAACTTGATTCTTTAGTCAAGAGCTTATACAGGATTTGTCTGTAAATGTGAAGTTTAGCC
CCTTGGTGTTCAGGTGCATATGATGACATTATTTAGCGACCAAAGTCTGATGCAGATGAT
TGCAGTCTATTGTCTGATGCACCTATTCTAGTCTTGCTCTAAAGTAAAGTGTGTGTGTTA
GGGCAGCTAACTCCATTTCCTCTCATCTCCCCTAGGCTTGACCACTATGCTATCATCAAA
TTCCCACTGACCACCGAGTCAGCTATGAAGAAAATAGAGGACAACAACACGCTTGTGTTC
ATTGTGGATGTTAAGGCCAACAAGCACCAGATCAAACAGGCCGTGAAAAAACTCTATGAT
ATAGATGTGGCCAAAGTCAATACTCTGATACGGTGAGTGGGGCCAGGCAGCAAGCTTGTG
TGGGGTTACTTAAACACACCATGGCTTCATGGTGACTCCTAGCCCCTCTGCAGATGATGG
AAAACTCAATGTTTGGAAAAGAATGACACCAACAAAGGAACCACTGATGCTCCAGAGGAT
TGGGGTGGGGGAATGAGGGAAGGGATGGGGTTGTGAGCACCCAATGCTGAGGCTTCCTTC
TCCACACAGGCCTGACGGAGAGAAGAAGGCATATGTTCGCTTGGCTCCTGATTATGATGC
TCTAGATGTTGCCAACAAGGTAAGCACAGTCACTTCTGTCTAGATACTACATCTACATCA
AAATCTGCCTTACTATCTCTAACAAGCCCCACCCTCCTGTTCTGTCATCCCAGCTCGCTT
TACCTTAAGGAGTTCAGCTCCAGTAATTTAGCTCCCTTTTTTGTTTTTCAGATTGGGATC
ATCTAAAGTGAGTCCAGATGGTTAATTCTAAATATATACTTTTTTTCCACCATAAATAAT
GCTGCTTGTCATTTGTTGCTTTCTGATTGGGGTGGGGACAAGGCCATACTGTGGTAATAG
GGTGGGTGCTGGGATCAAACCCAGGGCTTTCCCAGCTCTGAGCAATGAAGACTTCATATG
CTTAACCCAATGGGACACACCATGATGCATCCCGCATGCTAGATTAACTCAGTACCAGGG
GCCATTTATTAGACAGGTGTTAGTTGCCCTGGAACATGGCTCCATCACAGGCTCAGAAGA
CAAGCTTTACAAGAGTTCCTTCCCTGGCAGAGACTGTTGTGAAACCAATACCAGAGTTTG
GAAGAGCTGAGGGGTTATTTTAGAGCTGTCAGCGTCCATCGCGGGGTGGTATGGGTTCAC
TGGCTTTTGGACAGCATCTTGTCCTCACCCATTTACCATGCCCAACCGGTTGGTCTGCTT
CAACCCTTGCCCAAGAACAGAGGACTTCAGAGAGCTTTCATTAGTGTTTTCAATAGTGTG
GGTGTAAGCTTAAGGTGGAAAGGCTGGCCCCAGAATACACCCAGGCTTGGGGCAGAGTCC
TAGTTTATGTTACAAAGCTGTTGGCTGTGCTTGCTGTCCCTGTCACACATCCTGGGATCT
CCTTTCTCACTCAGTCAAGAATTTGTCTTTTTGTTGGCGGCTGGGAGCACGTTCAGGGCA
GAAATCAGAACGGAGGAGGCGAGAAAAGTAGATGAGTATCATCACGTCCAGCATAAGCAG
AATAGACAACAAGAATGTCCCCAGGGTCCTCTGGCCAGCATACTGTAGGAAGAACTTGGT
GAGGTAGGCCTGAGGTGCCAGTCTGAAGAGAAAGTACATGACCAAGTTGACATACTTGTT
GACCTTGTAGAGGAGGATATCCTGGGCATTGTTTATCTTCATCATCATCCTTAAGGTGAG
GAAGATGTTGCTGACCTCCACCAGTAGTGTTAAGACTCCACCTCCAACAAATCTTTTCCA
AAAGATACCAGAGAAGAAGGCGCCCATAGCCTGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1036, 1568..1751, 2975..3151, 3369..3438, 3591..3653
1012..1036, 1568..1751, 2975..3151, 3369..3438, 3591..3602
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved