Rattus_norvegicus Locus Tsr1
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Tsr1
Rattus_norvegicus
Tsr1
10
SNORD91, SNORD91
8802..8894, 9512..9602
13411
CAGCAGGCCCGGCCCCTTCCCACAGCCGGCAGGGAGGGGGTGTGTGCGCTGCGACTGGG
GGGGGGGGTCAGGGCGGGTGCGGACGCCTGGGGGCGTCGGGCCCGGGCGCGCGCCGCAGG
GATGGTTGTCATGGCGACCGGCCCGCTCCCGCCCCGAGGGCGCGAACCCGCATTGTGAGC
GCTGGGAGTCAGCCTCTCGCCACTGCACAAGCGGGCAGACTTTGAAGAGGTACTTACTTC
TGGCCTAACCTAAACCACAGTAACCGCTCCCTACTCCTGGCCCCTCGGAGAGGCGTTAAG
GAGCCAAGGTCTCGGCTCTGGGTCACTGTGGTTCGAACATGATCCTGTCACTCCTCCGGA
TCCTGTGGCCTGCCAGCAGTTCTTAGTCGCAACGCTTGCAGGAGAAAAGCAAGAACCCGA
CCACGAGCTACGAAGAGCAGGTGCCCGAGCACAAGAGGAAGCCTTCGCTCTCCTTCGGGT
CTCCACGTCCGGTTTTTGTTCATCTTGCAGAATTGTTGGGAGAGAGGGGCACGAGTCGGA
GTAAGAGACAGAACGGAGCCGGTGACACGAGTCCCTTCTAAGTGACTCGCGTTGGGAATT
AGAGTCATAGAGGAAAGAAAAGGATACCCAGTTACACGTTTTATTCCTTTATACAATTCA
TTGGGACCGGAGAGAGCGGCGTGGAAAATCTACTTTTATTTCTTCCCATGTGATGTAACT
TTAGGGTGCAAAGGTGGGAAGATGAGAGCAAAGTAGATTTTTCTAATCAAGAGACGAAGC
CGGGAGATTACTACCGGCGTCTTTCAGCTCTCAGCAGACGACTGCAGCGTGGGAAAAGTT
ACCACGACGTGTCCGCAGAGACTCAGTACCCCGCGCTCGCAGGCTGGCGAAAAAAACCTC
GCGAGAGGTCACGGGAGCGTAAAGACAAGTCCCTCTCGCGGGCCGGAAACGCTCGGGTCA
GCCCGGAAGTAGTGTTTACTCGGTGCACGTGGGCAGTTAGAATGGCGGCTCACCGCTCCG
GGCCGCTGAAGCAGCAGAATAAAGCTCATAAAGGCGGGCGGCACCACGGCGGTGGGTCCG
CACAACGGGACAGCAAAGGTGCGTAGACAGAGGAGGGAGAAGGGCTGCTTAGTCGATACC
CGTGCCCGGAGATTAGACTTGGGACTCGTGCCAAAGACTCTTTTTAAGGAGCTTAGGGAA
GTTCTTGTCTGTTAATTTAACCGTGAGGAGAACAGCCACTTCTGATCTGCCTTTCAGGTC
GTGTAGGACCGAAAATCCTGTGCAAGAAGCTTAAGAAGCAGCTCAGCCGAGTAGACCAGA
GGCATCGCGCCAGCCAGCTCCGAAAGCAGAAGAGGGAGGCGGTGAGGAGTGGGGGTTGGG
AAGCGGTGAGGCCATGGCTTCAGATTGGTAAAGTCTCAAACTAAAAAAATGTGACACGGA
AATGGGCCGAAAACGGGTAAACCCAGGGTACCTTCGGGCCGTGTTCTTAGTACGACGCCC
CTCCAAACTCCTTGACAGCACATACATACACGAGGCAAGAGAATGCTTGGTTATCTTCAT
TTATACGGACTTGCTCTTTTGCAGAGGAGGAGGAGGAAAGGAGGAGGAGAAGGATGATGA
TGATGATGATGATGATGATGATTTTAAACAAAGGATCTCACTAGGTAGCCCTGGCCGGCT
GAGAACTCAGAGATCCTCTCTGTCTTCTGAGTGTCCGGTTTAAAGGCTTGGGCCACCACA
CCTGGCTGTTCCGATCTTTTCTCATGTTTTACGTTACATAAATTTCCCTTAGTATTTTTA
CAGAGCAACAGAAAGGAGAGCAGTTGTGCTTTGGGGTTGCAGCATCTGTACTTTTGAAGA
TGTAATGACTAGTGAAGCAAATGATTGAGATATTCTTGAATCTTTGTGTTCCTAGGTTCT
GGCAGAGAAGAGGCAGCTGGGCAGCAAGGATGGGCCTCCACATCAGGTGCTGGTGGTGCC
TCTGCACAACAGGATTTGCCTTCCAGAGGCATTTAAACTGCTTCAGAACGAAGACCTGGG
AACAGTGTATTTGAATGAACGGGGAAGCACCCATAGTTTTATGCTTCTGAGCCCTAGCTT
GAAACATCGGTGGTCTTTCACATATGCAAGACCAGGTTAGGGGATCTAATCCTTTTCTCT
TCTTATGTTTAAGTGGTTCTATTTCTTGATTACAATGTGCTAACTATCTTTTTTTTTTAC
GGTGTCTTTTATATACAGGGGATCTGCATACACTATTAGACATGGCTAAAGTTGCTGATA
CCATCCTGTTCCTCCTGGACCCATTAGAAGGCTGGGACAGTACTGGGGATTATTGTCTAT
CTTGCCTCTTTGCTCAGGGCCTTCCCACCTATAGTAAGTGTGTTCTAGTATCAGTGAGAC
CAGAAAACAAAGTAAATTTTCCTTTCATTTTTTTAAAGATTTATTTATTTATTATAAGTA
CACTGTCGCTGTCTTCAGACACACCAGAAGAAGGCATCAGATCTCATTACAGATGGTTGT
GAGCCACCATGTGGTTGCTGGGATGTGAACTCAGGACCTCTGGAAGAGCAGTCAGTGCAT
TTAATCCTTTTATCTTTTAACAGCTCTGGTCCTTGAGACGTAATGTTTAACACTTGGTTT
AGGAGTAAATCAAGGAGTTGAATTCTGCTGGCCTGGGCTATACTTGTCCAGATTAAACAT
TATTTTCATATATTTTAGTTTTTGGTGGTGTTTGCTTGTTTGTTTTGGAGACAAAAAGTT
CCTCTTATGTAACCCTGACTGTCCTGGAACTGTTCCTGTAGACCAGGCTAACCTTGATCT
TACAGAGATTTGCCCCCTACCACCCAATTCCAAGTGTTGGGATTGAAAATGTGCACTGCC
ACCTAGCTTTTTTTTTTTTTTTTTTTTTTTGGTTCTTTTTTTCGGAGCTGGGGACCGACC
CAGGGCCTTGGGCTTCCTAGGTAAGCGCTCTACCACTGAGCTAAATCCCCAGCCCTATTT
TCATATTATTAAAGAGAACTTTTAATTTCTGGGCTGTCCTGTGCCCAGGAAAGGACTAGG
AAGTTAACACTCATTGTGACGTTTCTTTGGCTGTTGGGAGGTTTATGAAGAACTGGAGAG
GGATCTTCAAGCAGTGGAGCACTAAGCTCCTAAGTTCTTCTCTCTTCTTTCAGTGCTAGC
TGTCCAGGGACTTCCTAGTCTCCCACCAAAGAGACAAACGGATGCCAGAAAGAAGCTAAA
TAAAACAGTGGAGAAACGCTTTCCTGAAGACAAACTCCTGCTGCTGGACACCCAGCAAGA
ATCAGGAATGTTACTCAGACAGTTGGCTAACCAGAAGCAAAGGCATCTTGCTTTTCGGGA
TCGGCGAGCTTACTTGTTTGCCCATGATGCTGACTTCATGCCTAGTGAGGAGAGTGACTT
AGTGGGCACCTTGAAAATCTCAGGCTACATTCGAGGGAGGACTCTGAATGTAAATAGTTT
GCTGCATATTGTTGGACATGGTGATTTCCAAATGAATCAAATAGACGCGCCTGTGGATCC
TTTCCCTTTAAATCCTAGAGTGGTTAAATCCCAAAAGAAACCAAGCATGTCAATGGAGGT
AAGATTGGTGTTTCCATTTCTGGGAGTCTAACTCACTTGGCTACATTCCTTGCCTGAGAT
TGTTTTTAATTTTTTTACTGAATTTATTTTTGTGTGCTGGAGAGGGGTATATTACGAGTG
TGGAAGGCCTTGTGGGGCCACCCTGCTTTTTAAATTTCAGAGCATATAGTTTGCATGCTG
AGGCCAGTGAGGAGACTACTGCTGGTTTGAATTGTAAGGCAGTAGGAATTCAGACACATG
GTAGTTAAGTGTATTTATCCAATACTTTCTAGATTCTTTTCTCAGAACTTAATTTGAGTT
AGGAAAAAAGTACTTGTGAACTTAAAAATTACAGTACTTAAGGTGCGGACCTGCTGTGGA
AATTGAGTAAACTAGCTAGCTGCACAGGAGAGCTCAGAGTTAGCCAAGTGTGTGGCAAGG
ATGAATCTTAGTTCAACAGAGCCGAAAAAATATGTTGGGACTTTGAACCTACATATATAT
AGTGATGGAGTAGAGGAATTAAAGCACTGTCTACCACTCTTGGCTTTCTTTGAACTTTTT
TAAAAGACTGGACCTCACCATGTAGCAGTGCCTGGCCTGGAACTTAATGTATAACCAGGC
TAGTCTCAAACTTTACAGAGGTCAGCCTTCCTCTGCCAGTTGAGTGCTGATCAAAGGCGT
GCACCACCATTCTGAAGAGAGCAGCTTGACTGAAAGTAGTGTGATAAGCAGGAGAATGTC
AAGGTTGGTAACAACCTCAAAAGGTTAGAGTTGAGATGCTAGGGGATAGCTATTTGGAAA
ACTTGTTTCTGTTTAATTTGTGGATTTCTTTTTGAAGATTTAGTTATTTTATATAAGTAC
ACTGTAACTGTCCTCAGACACACCAGAAGAGAGCATCAGATCTCATTACTGATGGTTGTG
AGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCGGGAAGAGCAGTCGGTGCTCC
TAACCACTGAGCCGTCCCTCCAGCCCTGACGTGTGGATCTCTCAGGTGAATGTCTGACAG
GCTGTTGCTTGCTTTGGGTCTTAGGTTTGTGTTACAGACGCTGCTGCTGACATGGAAGAA
GGTCTTAAGGTTCTGATGAAGGCAGACCCTGATCAACAGGAAACTTTACAAACAGAGGTT
ATTCCAGACCCAATGGAAGGCGAGCAAACGTGGCCCACTGAGGAGGAGCTGGATGAGGCA
AATGGTCAGTGGTAGCAAACATGGTACTTTTCTGACTTTGATTTTGCATGGCTCTTTACT
TGGTGTTCATATACTTAGAGGGCTGGATGAGGAAGTGGTTGACATTTAAATACTGAGTGG
TTGCACTAAGCAAACACTGGGCACGGCTTCTCTAGAAATCACCCCAAGGTTCTTTCTTTT
TTTTTTTTTTTTTGGTTCTTTTTTTCCGGAGCTAGGGACCGAACCCAGGGCCTTGCCCTT
GCTAGGCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCCCAAGGTTCTCTTTAAGTA
ATAAATGACCCTAGGTCCACTGCAGGGTTTACTTCGCTGTGTATTTGTTGGTAACTGTGA
GGCATCTAAACTAAATATGGAAGTAGGCTGTTCTCGTGTAGCTGCTTTTTCTTGTTGGCA
GCATTGCCTGGCTAGGTGAGGAGAGAGAGAATGGTTTGTGCTTTTACAGACTCACTGAAG
CAACGCTCCAGGGTGGTAAAGAAGGTCCCTAAAGGAACATCCAATTACCAGGCTGAGTGG
ATTCTGGATGAAGGCGATGAAAGTGATGGGGAAGGTGATGAATCTGATGATGACATACAG
CATGAAGGTTTCATGGAAGAAGAGTCTCAGGTAAGAAAGCGGGCCACTGGGCTATGTATA
TAGCTCTAAAACCAAGGCTGCTGTAAAGTCAGCTGCTGAACATGCCTGTAACTCTAGGGG
ACATGTGAATCATTTATTTTGAGGTTGGAAAAATGGCACGTTGGGTAAAGTGCACGTGTC
ACTTACGTTTTAGGACTTGCACTTGAATCCCCAGGACCCATGTGAAGCCAGATGTGACAG
TGTAATTCTGTGAACTCTGTGTTCCTATGGCAAGATTTTTAGTAGAGACAGGATCTCTGG
AACACTGCGGCCAAGTTAACAAACATTTAAAGATCCTGTCTCAAGGCAGAAAGTGAGGAA
AGACAGTTGAGCTCTTACTTCTACTGGGATGCCCGTATTCAGATGAACATGGTCTCACCT
TACATTTTTATATTTCTGTCTGGTTGCAGATAGGTGTCTAAGAAAATCTGTTTAGTTGCT
TTTGGAGCAGAAAGGGGTGGATTCTGCTGAACGGTCTCCCTTTTTTGTTTACATTTTTTA
AAGAAAATGTTCTTACTAGCCCATAGGTGACCTTGAACTCTCAGCAGTCCTATCCTAATC
TTCCCAGAACTAGGATCCGAGGCATGTGACCCCAAGCCTGATTGCTATTTTTTGCTTTTT
AAATGTTGGGACATTTTACTACTTTCTTTTCTCCTGACAAGGTCTCATGCATCCTATGTA
TTAACTCAGCCACTGTGCAGCAGAGAATGGCCTTGAACTCATTCTCTTGCCTCTGCCTCC
CCAGTGCTTGGATTATAGAGCTAGCATGATTAGTTTTGGAAGTGGTGCTCGAAATCAGTT
CCTAGGGCTTCACAAATGCCAAGTGAGCACTTCACCAGCTGAGCCACACCCATACACACA
CTGCTTTTAGGTGTGTGTGGGGGCATTTGAGAGAGGTTTTGAGACAGGGTCACATACTGT
TCTGTTCTGGAACTCACTATGTAGACCAGGCTGCCTTTGAACACACAAAGGCTGTGATGG
AAAGTGTCCATCACTATGCCCATCTTGCATGCTTGTTTGTGTTTATATGGGACCTGGTGT
GTGATAGTCAGGAGCAGCTTACTGGAGTCATTTCTTCCTTTGTACTATTTGGATTCCCTG
GATAGAACTCAGGTTTAGAAATGAGGTCATCGGGGGCTGGAGAGATGGCTCAGAGGTTAA
GAGCACTGTCTGCTCTCCCAGAGGTCATGAGTTCAATTCCCAGCAACCACATGGTGGCTC
ACAACCACCGATAACGAGATCTGGTGCCCTCTTCTGGCCTGCACGTATACATGCAGGTGG
AACTCTGTGTACATAATAAATAAATCTTAAAAAAAAAAGAAATGAGGTCATTGGGGTTGG
AAATAAGCATCTTTATGTATTCAGCCACCTTTGTGGGTGCTATGACTTTCAATTTTTTGG
GACATAGTCTTATATATCTCAGGCTGCCTAGAACTCTGTAGCTGAGGGTGACTTTGAACC
CACCTGTTGATACTGTGGCATGAATCTGGCCAGCTTTGGGCTCTAATCAAGAGTTTCATG
TGTGCTAGACAGGAGAGCACTCTGCCACTTGAGCTACACCCCTGCCCTTTTCTGGGGTTG
TTGATTTTTGTTTTATGAGATCTTTTTTGGTTTTGTTTTGAGACCATTTCACTCTCACCC
ATGCTGCCATCAAACTCTTAGTGAATCACCTTCCTCAGCTTCCTCAACGTTAAGCCTATG
TTTCTACTGCCTATTTTTAATCCCCTGTTTTACAGGATGGGAGTGGCGAGGAGGAAGAGG
AGGAATGTGAAACCATGACTCTAGGGGAGTCTGTGCGTGATGACCTATACGATGAGAAAG
TAGATGAAGAGGACGAGGAGAGAATGTTAGAGAAATACAAACAAGAAAGATTGGAAGAGA
TGTTTCCAGATGAAATGGATACCCCTCGTGATGTGGCCGCTAGAATTCGGTTAGTAAACA
AGTGATTTCAAACAAGTTTTATTTAGAACTTTCATGGTTTAGGACTATGTGAGCAGAAAG
CAAATGGAAAGGAACACTGTCCTTGTCCTTGAAGGGCTAACATGCTATATGAGAAGCAGC
AACAGACAGTCAAGGTTTAGTTGTTCAGAGAGCCCCAGGGAAAGAGACATATGAAGGTTA
ATTAGCAAATTTTTTTGTAGGAGTAAATACTCAGAAATATATATTTTTTTGGGGGGGGAA
GTAAGAGTATATGTTTTGAGTGAATGCTGCTAAAAGTAAAAGCAAGAAAATGTAGGTGAT
TTTTCTGGAAGCAGGTCTGACAGAAAGCTGTGATGTAAGGCAGGTTGAAGAGCCTTATTG
CCTGACAGGTACCAGGCAGGCTGTATAAGACTTGTTCCCTTTGAAAAGCCTGGGTTGATT
CTGAAATACGTAAAGTTTGGAGATTATTTGAGAGATAGGGTTTCATATAGACCAGGTTAG
CCTTGATCCTCTACTGTTCATGAAGGTTTGTGTTTCCAGGTTCAGTTCTAGCTTATTAGA
CCATTTGGTGCCTTAGTTTCCTGAGGGAGCTTTGCTTCGTAGTTCAGCTGCTGTGGAACA
CCAGATTCTGGCCGGGCCTCCCTAATGCCAGGCTTTGTTATGCTAAGCTGGAGATTGAAC
CCTGGGGCCATGTGTGTCTTAGATAAGCATTACACCACTGAGTTACATCCCCAGATAAGA
GTACTTTGAAAGAGCCAGAGCCTTAACCATTATACAAGTGCAGTGAGTTTTACATAGCAC
CATCTAAACTAAACCTCTTACTTTCTTTAAAACCTGTGCTCTAGATTTCAGAAATATAGA
GGCCTCAAGAGCTTCCGGACGTCTCCTTGGGACCCTAAAGAAAACCTTCCTAGAGATTAT
GCTCGGATTTTTCAGTTTCAGAATTTTGTTAATACCAGAAAAAGAATCTTTAAAGAGATT
GAGGAAAAAGAAACTGAAGGAGCTGAGGTACCTGCCTTCTGTCTACCTTCTAGTTTGTTT
CTGTTTGATACCATTCTGCTTGTTTGGGAAAGAGGAGGGGTCAGAGATGAGCAGCTGTGG
AGGTTGAACCTGGGTGGTTGATGCATCCATGAGTCTGGAGCGATGAGGCATATACCTGGA
GAAAGGTCTCGTCGTTCGTGCTGTTAGGGTAACCCTGTGATTGTTGTGCTTCTTCCTGCC
AGGTTGGTTGGTACGTCACACTTCATGTTTCTAATGTCCCTGTCTCGGTGGTCGAGTCTT
TCAGGCAAGGAGCGCCCTTGATTGCATTTTCTTTGCTACCTTATGAACAGAAGGTAAATC
AGTGTTTTGTGGGGAATGGAGAAAGACAAATATTTTTCCCAAGTGTCCAACATTTTGCTC
ACTGGGATGTGAGAGCCTACCTTTTTGATTGAGGAATTAGAATAGAGAAGTCAATGATGG
TTAAGCCCAAGATGTCTGAACCTGTCTGAAGCATCTTTGTGATGCAGTCTGTGTGGTTCT
GAGACTTCTCTTAAGTGTGCTTTTTCAGATGAAAATGGGGGTTAGCAGTTGCAAACTTAG
ACGTGTATGCCAATGTATAGATCTGTTCTCTAGGGAGACTATAATTGTGTACTGGGAGTG
GGAAGGCTGGCGTAAGGGTTGAAGAGGCTTGGATGATTGTGGCTGGGAGGGTATATGTTG
TAAAGGACATTTACTGTGGCTCTTTAATAGTGATGTGGAACAGTAAGCTAGCTTAGATGT
GTGCATGGAAGCACTGATGAGGCCTAAGTGCACCCATGTCGTCAATTGGTGGATAAAAAG
GACGGGTTAAGTAGTGTGGTCAGTTCTTAGAGTGAATCTGGTGTTTGTTTGTTTGCCTTT
CAGGTTAGGCTGTTGTATGCCTAGATTGTGAAGCTTTTTCTTCTTTGGTCCTCAGATGTC
AGTATTGAACATGGTGGTGAGCCGCAGCCCTGGCAACACGGAACCTGTGAAGGCGAAAGA
AGAATTGATCTTCCACTGTGGATTCAGGCGCTTCCGAGCTTCACCTTTATTCTCTCAGCA
CACAGCAGGTAAGCATAGAAGCCGCTGGAGTCTTGCCACCTGTTCTGTATGGTTGGAAGT
CTCTGGGATTAGAAATATCTTTAGTACTCTGACTTAGGAGCCAATGATGTCTTTATCCAA
AATGTCTGAACCTGTCTGAAGCATCTCAGTGATGCACACTGTTGTGCTGAGGCTTCTCTG
CTCTGAGTATGTGTTCCAGGATAGGTTTTAAACCTGAGTGCAGCTTCAGGAGCAGCAACA
TGTGTGGCCTGCTCACGTGGGCCTTTTGCCTTTCAGTGATGGGAGACATGGTGCTCTGGG
TACATTCTTTTACCCATCATGTTAACATTTTGTAAACAAAGTTTTATTGAAAAATGACAT
ATCTTGTTGGATTGAACTTGGGGGCCTCCCACCTTTATCTTCTAGTATTATTATTACTTG
TGGATGACTGTCTTGTTTTACTTTCCAAAAGACTAGGTGAGACTAGGTCTTAATATGTTG
CCCAAGCTGGCCTTGACCTTCAGAATGCTGGGAGTACCGAGGCGTAGGAGTAACCACCAT
GCCCAGCACTGTTACAGAGGCTCACTGACAGACCTGAGTAACTGAAATGTAAAGTACTAT
GAACAAGTTGCTGAGCCTGAGGACCCACTCCTCTGACTTTCTGTGCTACTGCTGTAGCGT
ATGTATTCCCACACCCCCAAAATAAATGAAATGTATTAAAAAGCCTTTATTATTTTGGGA
AAGTAAGGTAAACAGTTTTCCTACAGTTTTCCACCCAGCACAAAAGCAGTCAAACAAAAT
AAACTGGTAACTTTAGCCCTTGATGGCAGAAGGTATATAGCAAGTTCAAGGCCAGCATGC
AATACTCGAGACTCCTCTCAAAACAAAGCGGACAGGAGCTTGTAAAGGACCCAGACTGGA
TTCCCAGCATTCACTTTGGTCAACTTAGAGGCACCTGCACTCAGACACATACACAGAGAT
ACAAATCTTAAACACTGAGGACATGAGGCTATGGCAGAGCACTTAGCGTGCATACAGCCC
TAGGTTTAATCTCCATTACCATAATTTTAAAAGGTGGGGTTCCCTGTGGCAGTAGTACAG
CTTTTGATACTTTGGATTGCTTATGATTTCCCAAAAGGCCTTTTACTTTTCTCTCTGTTT
ACTTATTTTGGACCCGTACTATGGAAGCTGATAAACATAAATTTCAAAGATTCCTGACTG
CTGATGCGGCCTTAGTGGTGACAGTATTTGCACCAATCACGTTCCCTCCTGCATCTGTGC
TGCTTTTCAAGCAGAGGAGAAATGGTATGTTGAATTCGGGGTATAAATAACGAGCGTACA
AGTACCCACTAGCACCATAGCTGTCTGTACTTAGACATGGGGTCTTGCTCCATTCATGAA
TACACTCCAGGACAGGCTACACAATGCATGTAAGGAGGGTGTGAGGGGCTTGTGGTCTTC
CTATAGCCCCAGGAAAGTAGCAGATGGGTCCTAAAAATAGATGAGAGCTGGAGGACTTGG
CCTGTAGATTAACGGCTTCTCCTCCGCTTAGGAATGCACAGCCTCATTGCTACAGGCCAT
CTGTTTTCAGTGGATCCAGACAGGATGGTCATAAAGAGAGTGGTTCTAAGTGGTCATCCT
TTCAAAATTTTTACTAAGACGGCAGTAGTGCGCTACATGTTCTTCAGCAGAGGTAGGTGT
GAGTGGAGAGGGTGCTGGGAAGATGGCCCTGACTGACACGTGGGCAAACGTTTGGTGTTA
TGTCTGTTCCATTCTAAGACGATGTGCTGTGGTTTAAGCCTGTGGAACTGAGAACCAAGT
GGGGCCGCCGGGGACACATCAAAGAGCCGCTGGGTAAGACCTGGCGTTCCCAGGTGTTCC
TTGGGACTGGTGGGCTGGAAGTTCACTGCTTAAAAGTGTCCACTTTACTTTGACCAATTA
TGTGTTTTTCTTGTAGGTACACATGGCCATATGAAGTGCAGTTTTGATGGGAAGCTAAAA
TCTCAGGATACAGTATTAATGAATCTCTATAAGCGAGTGTTTCCCAAATGGACTTATGAC
CCGTATGTACCAGAGCCAGTACTTTGGGTTAAAAGTGACATCTCTTCAACAGTGTCTGAA
GTAGACATGGAGTAATGGCCACTCAGTTGGGTTCCTCCAGCCAAGGCTCCAGTGTTGGAG
TTGTTGGGTTGTGACTAGGCTGTCTGTGTCTCTGCTAAGTACAGGATTTATACTATAACA
TACTTGATTGGGATTTTGAAAATAGTTTAAACAGGAAGATGGAAAACAAAACTTTCATCT
AGAGACTAAATTGGAACAGAAACAGTCTGTTAAGGAGCCGGCCGTTCCGCCTGCTTCACC
CAGCTTAGGGAGGTTAAGTCTACATTCCCACCACTGAGTACAATACAGATGTTCTTTACT
TCTGGAGAGACAGTTTGGAAATGCTGAGATAGCACTGCAGCCAATCCGACGCCAGCAGTA
GGCTCAATGAGCAGTTTCATTCTTTCCCACACCAGCTGGGTTGCATACTGTTGCACAGAA
AGAAGCAAGGGTTAGTGAAACCAGAAATTGTAAACATGAAGTAGGTGAGCTACCATTTCC
CACAGGTTAAGGGAATGGTCTGTCAGTGCCTGGGAAGTTAGACTGGCTGTTTATGCATCT
GAGTTTACCTTGATTTCATCTTCCGTGACAGTGAAGACATCGTCCACAAGGTCCCTTATA
ATAGGCCAGGTATTTAAGCCAATGCTGGACTTGACGCCATCTGCTATGGTCTCTGGAGGA
TGAAGATTGGGGGTCAGCTCTCCTTTCAGCTTAGACTGGTAGCAGTCATCTGCATTGGAA
GGTTCAGCAGCGTACACCTTCACGCTAGGTTTCAGGGTCTGGGAAAGGAAGAGATACATT
AAATACCGCCGTTGTCTGCACACCTCAAGGAGGCAGTGTGCTAAAGATGTGTTACATTTG
ATGACCAAAATGGAAACGACCTTGAAGCACTTTAATAAAAATTGTATCTGATAACTGGCT
TGTCTACATTAAGATTGGGAAGAGCAGTAGCTTAGTGAGGTGGGCTTAAGGAGTGAGGAT
GCCACCATTGTGATGTGACTGTTTTTATGGCAGTGTAGATCAAAAGGACAATTGGGCAAA
GAAGGCATGAAAGGTCCTGTGCCCGGTCTAGGAAGTTGCTAGAAGCTATTTTCTTTTCTC
TCTCTCTCTTTTTTTCTTTTTTTTTTTGGTCTTTTTTTCGGAGCTGGGGACCGAACCCAG
GGCCTTGCGCTTCCTAGGCAAGCGCTCTACCACTGAGCTAAATCCCCAGCCCCTCCTTTT
TTTTAATCTTTTTTTAAAAGATTTATTCATTTATTATATATAGGTACACTGTCGCTGTCC
TCAAGGACACACCAGAAGAGGGCATCAGATCCCATTACAGATGGTCGTGAACCACCATTT
GGTTGCTGGGAACTGAACTCAGGACCTCTAGGAAGAGCAGTCAGTGCTCTTAACCACTGA
GCCATTTCTCCAGCCCTAGAAGCTGTTTTCTTACCTTAATTGTAATGGCTATTCCAGCAA
CCATTCCTCCTCCTCCTACTGGTACCACCAACGCATCTACCAAGGGAACCTATAGTAAAA
ATGTAAATATGCAATTAAAGCTTTATATGTACATACAGTCTACAGCAAACCACTTCACTA
TAGGTAAATAGATTTATGCCATCTTACCTGGTTCAGCACTTCTAGGGCAATTGTCCCTTG
TCCCGCTATCACTGCAGGCTCCTGGTTGGGATGGACCAAGATGCCTTCTGTTTCTTGTAT
AATTCGTTGAGCGACGTTTTCTCTGGACTAAAAGGTAGCATTAATGTGTCGTACTTGACT
TACAGTGAATTTAGTTCCCCAAAAGTTCAATTCTTAATACTTTTAAGACAGAATTTTTCA
CATTTCTCTCCTGAGAGTAGCTATAAATAACATGGTGTGTTGGAGTATTTTCCATTGAAT
GACCGAGGAGTTTCACTATATGATGAGAACAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1257..1360, 1915..2134, 2238..2372, 3173..3597, 4644..4803, 5269..5429, 7175..7368, 8204..8366, 8582..8692, 9295..9427, 10587..10703, 10951..11091, 11178..11252, 11356..12411
1001..1097, 1257..1360, 1915..2134, 2238..2372, 3173..3597, 4644..4803, 5269..5429, 7175..7368, 8204..8366, 8582..8692, 9295..9427, 10587..10703, 10951..11091, 11178..11252, 11356..11531
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved