Rattus_norvegicus Locus Eif4a1
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Eif4a1
Rattus_norvegicus
Eif4a1
10
SNORA67
5436..5578
7508
TCCTCCTTCCATGTTCTGAGGGCAGGAAAGCAGTGTGGGGGTGGTGGGCACAAAGGGAT
TACTGCCTGCCAGATCTTCAAACTTTTTTTTATATATATAAATATATATAAAAATGCCAC
GGTCCTGCTCTGGTCAATAAAGGATCCTTTGAAGATATGCAAGTGGTGGTCTTCCTTGAG
GGGCCTTAAAATAGTGGATGTGCTTTATCTCAGGCCTTCAAGCTAATGCTATTAGCTATC
CCCTTTTCAGGTCTTCATCTTAGAAACCAGCTTTTTATATATGCCAATCCCAGGGGAGCA
GATGGCAGTAAGGATGTGAATTACAACTCATGAATAAAGGAGCCTAGGAGAAACTGGGAA
CAGACACTAAATGAGCCAGTGATGTTGAGTGGGTCAAGATCCCTGACAGATTATCTGCCC
TGCTCCCGCCCTAATGCCCTTTTGCCCAAAAATGGATTCCATCCTTTTTCTCCAGTCGGG
GAAACTTACTATCCAATGAAATATCGCTACTGTTCTGTCATTCTGCTGAACCAAATACAC
CATTCTTTCCTGAACCGAAGAATAAATAAAACTTGTATCCTGTAGAAACCTGGGTAAAGG
AAAGTGGCAGTCCAGACTGCCCGGAAGTCCCTGGAGGCTAAGGCCTCACCCCCGTGGCTT
GATAGGACCTGCTGAGCCACATGACTAAGGCACGATCGCCTCCGCACGTGTAAAGGTGCT
GGGTTCCAAGATGGCTGCCCCGCCGCGAGGCCCGACTTAAGTATGTCACTTCCGCACCAG
CAAGAAAGGCGGGCCCTTCAGCCAATGAGGCTGCAGGGCGGGGCTCAGCCATGATAGGCT
TTCAAACTACCCAATAGGGCGTCCGAGCTAAAGCGCCTACAAAGTAACGTCACGTCGAGT
TGCAGAGCGCCGGCAGGCGGGGCAGAGGCGGCCAAGCCAATGCGATGGCTGGGGCGGGGT
CGGACGCTCTATAAGTTGTCGATAGGCGGGCACTCCGCCCTAGATTCTAAGGATCATGTC
TGCGAGTCAGGATTCTCGGTAAGAAAGGCATTTGCAAGAGGTTAATGGCTACTTACCCCG
CAGCTCCCTTCCGAAGGTCCCGCCGGGGAAAAGTTGAGAGACCCATCGCACCAAACCTAC
CAGGTTGCGGGAGAATCGAACCGGGAGGAACCGTCCGGGGAGGGGGGGGAAATCCCATGG
CCGACGCTGACACCAGTGTGGATACGGGAAAGGACGGCCTGGATAGGGCGGAGGGCGCGA
GGTTCGTCACGAGGCCTCGGCCTGTGGGGATGCCGTACGCGAAGCTTGGGTACTGAAAGG
CAAGATGAGGTCGCGACATAACGTGGGAAAAAGAAGAGGCGGCTGTGCGGCCCGGAGCCG
GCTGGTCTGGTTGCCTCCCTATGTTGGGCAGGGCGTGCGCGCGAGGGTTCCGGAGAATTC
TGGCGGTACCACTCGCGACAAGCAGGGGTGCCTGGGTCTTCAGCGAGTCCCTTCGTCGCG
CTTGGAATGTGGGTCGGGGAAGAAGAAACCGGCCGTTCGGGGTGCTGGTTTTCTTGACGG
CCAGGACAGAGCCTAACCCGAAGGAGCGGCCGCGTGAGGCACCAGGAGCCCACCCGGCGC
CGGGCGGGCGGGTCCATTTTGCCGCACAAGCCGGGCAATTGGCAAACTGCGGATGGGCAG
GTCCACTTTCCTTCGGGGGTGAGCGGCCTGAGGTATGGGAGGGCGACGCCATTTCTCGAC
GGGGGCGGGCGGGCTGCGGATTGTTCCATGGCGGGGGAGACGCCACCGAGTGGCGGAGCG
AAAGAGCACATGGCCGCTTGAGAGATTCCCCTCCCCCAGTCTGCTTCGCTTGTCTGTTGT
GCAATCTCCCCCTTTGCTAGCGCGGCTGGGGCTCATTGTGCGCGAGGCCGCCACCGCCCG
CGGCCTCCCACATCCGGGTACTGTGGAGGGGGGCCGGCCGGAGGGAGTGGGGGAGGGCGC
GGGCGGCATGACGTGGGGGGGAAGGGGACGGCCCACCCACGGAACTTGGAGGTGGAAGGC
GGGACTTCCGGTGGCCTTGGTGTTCCGGATGGAGGTGCACACGCTTTGATCCGCCAGACC
CAGAACATGTGGGCCTGGCAGCAAAGACCGCATCTCGGCGCCGTGTGTGTGTGAATGAAC
TCCTCTACAGCCCCTTGATCTTAAAGGAGGGTCACCCTAAAGTGCCTCTGGATGGTCCTT
TGGGAATAAGTGGGAGTGTTGGATCGGGAATGGGCTAGTTGCTTGCATGCTCTAATCAAA
GCATGAAAAAAAAACTAGTGCTTTGAATCAACAGATCCAGAGACAATGGCCCCGATGGGA
TGGAGCCGGAAGGCGTCATCGAGGTAAGACTAGAATCTGTGGTCGCCACTTTATTATGTC
CGAACAGGCATTTCCTTATGGTGACATAGACCTTAGATATTTAGGACGGTGGAACAGAGC
AGTAGGGTGGGGCGACTGCAGCTTTGGTATAAACTAAATTTATTCATTTTTGGTATCCTG
CAGAGTAACTGGAATGAGATTGTGGATAGCTTCGATGACATGAATCTCTCAGAATCCCTC
CTCCGTGGTATTTATGCCTATGGTTTTGAGAAGCCCTCTGCCATCCAGCAGCGAGCTATT
CTTCCTTGTATCAAGGGTAAGACTCATTATCAGGCTAGATATGGACTGTCCTGATCTGCA
TAGTGTGTATGGGGTTGGTGGTGGGCATAGCAATGGGGGTTGGGGGGACAACAAATTACC
TTTCCTAGCTTCTTGGTTCTGGGGTTTTATTTTGTCATGCCTTAGAGGGGGTTGCCATTT
CCAATTCGAGGCCTTTATTATTGCTTTATGTCTAACCTAGCCAGCTGTGTTTGAGTTCAT
AATGTTCTGGTAGATGGCACCAGCCTTGTTCCATTACTGATGTCAGGAAGTCTCACAGGT
GTCCTCTGAGCCTAAGGTGCAGACTTTTTACACATCTAACTCTTGATCTGGTTGTAGGTT
ATGATGTGATTGCTCAAGCCCAGTCTGGGACTGGGAAAACAGCTACATTTGCCATATCCA
TTCTGCAGCAGATTGAATTAGATCTAAAGGCCACTCAGGCTTTGGTTCTGGCACCCACTC
GTGAATTGGCTCAGCAGGTAAGATTGGTGTTTCCAATTCTATATGACTGCTTTAAGAGTT
CAAGAAGAGTCTGCCAGTGGTGATGATACTGGTGACCCAGGCATGTGGAGCACTTCAATT
TTAAGGCCAGTCTGGTCTACAAAACTAGTTCCAGGACAGCCAACACTTAGAGAAAGCTTG
TCTTAAAGAGACAATTAGAAGATCAGGTCAGGTACGCTCTTGTATGCCACTGGGATTTGT
TGACAGCTTCTAGATCTATTGAGATTGGTTTGCCTAATTACTAACAACTTTTCTACCAGG
AAAAAAAAGCACTTTAAATCCATTTTCTGAGTCAAATAAGGAAGGGAAGAGTATTGTTAG
AATCTAGCTGGCTGGGCAGGTTAAACTGTGTTTACAACAAACATACCACCCCCTGGACAT
GGGCAAGGAGACACCATGTTGGTGGTGTTGTTCCTATATCAGTCAGGGGCAGAGCAGATG
TAGGCCTTTGTTCATCCTAGCTTGATGCCTGGCTTGGTGGCCAAAGCTGTTTCATGCCTA
GGGCACATGAAATCCTGGTGCTAGTCTGTTAACTACTATTTCAAGCCTAGTGATCACTGA
AGCAAGCATCTGGGTAGCAATGTAAGCAAGACGTGATAAGAGGATTGACACCTTAGAACC
CTGTAGATCTACTTATTTTGGGGGTTTGCTTATGAGCTCAGCATGGATCACTAAGTCTTG
GTTCTGTAGCAGGGATGGAATAATCACCTTGTGGGTATAGATAGGGCTGTGTTCATAATC
TCAGCCTTTGGAATGGAGTAGTAGGATGTAGTGTGAGTTGTTTGTAGAGCTGGCCTGGTT
TTTATGAGGCTGCATGTAGAGTGGGAAACTTACTGTGAACCTGTGTGGACGGATCCAGCA
TTGCCATTTGGTGGCGGTATTGGTGGTGTTGGAAGAGGATTAAGTGGATTCCTGTTTCTC
AGTTGCTAAGAGTGGGATAATTCCTGTCTGTAATAAGAAAGACTTAACTCACTGGTACTG
CCCAAGTTAATGTAGATGCCTTTCTACATTTAGATTCAAAAGGTGGTTATGGCACTGGGA
GACTACATGGGTGCCTCTTGTCATGCCTGTATTGGGGGCACCAACGTGCGTGCTGAGGTG
CAGAAGCTGCAAATGGAAGCTCCCCATATCATCGTGGGCACCCCTGGCCGGGTGTTCGAT
ATGCTTAACCGGAGATACCTGTGTGAGTGCCATGGAACAGTTGTTGGGCTCTTTTCTACA
TTTCATTTCCTTGGATGAGTTTTCCTTTAGTTGGAATTGAGTTGCTCTGTGATGAACCCC
ATGCGTGTCATCTGAGCCTGGCTTCCCTGTTAACCTTAGCCCAGGTAGTGTTCTACTTAC
CAGGGCTTTTGCATGACCTATCAGGGAAGCCGAGGGCAAAGGATCAGTCCTTGCATTCTG
AGAGCAGACTGTCTGCCTTCTGCCTGCCTTATCAAGAGACCTCAATATATTTCACATTTG
TCTGATTACTATATGTTGGGGTTTTTTTTTTCCTGCCATCTAGCACCCAAATACATCAAG
ATGTTCGTCCTGGATGAAGCAGATGAAATGCTAAGCCGTGGGTTCAAGGATCAGATCTAT
GATATATTCCAAAAGCTCAACAGCAACACACAGGTAAAACAGATGGTGTTGGAGGGACGG
TGGCTCGGTTGTGATTTGATTGTACAGTGCACTCAATCATGGCTGGGGCATTTTTCCCAC
TAGGTAGTTTTGCTGTCTGCCACAATGCCTTCTGATGTCCTTGAGGTGACTAAGAAGTTC
ATGAGAGACCCTATTCGGATTCTTGTCAAGAAGGAAGAGTTGACCCTGGAGGGTATCCGC
CAATTCTACATCAATGTGGAACGAGAGGTGGGGCCCAGTGCAGGAGGCGGGCCTGGTAAT
AAGTGTTGGGTATAGCTCCTGATTGATGTTTCCTGATCTCCAGGAGTGGAAGCTCGACAC
ATTGTGTGACTTGTATGAAACACTGACCATCACCCAGGCAGTAATCTTTATTAATACCAG
AAGGAAGGTGGACTGGCTCACTGAGAAGATGCATGCCCGGGATTTCACAGTTTCTGCCAT
GGTGAGTTTTCTCAGTCTTGTTAATGATAGATGTGTCTTTGTGTGTTAGGAGCCTTATGC
TAGCTGCTCCTAACCTTGTTTTCCAGCATGGAGATATGGACCAAAAGGAACGAGACGTGA
TCATGAGGGAGTTCCGGTCTGGCTCTAGCAGAGTATTAATTACCACTGACCTGTTGGTGA
GTAGATGCTCTTTTAAGGAAAGAAAGGGAGAAAATAGCCCAAGGTGATTCCCTCTCCAAA
GGGCTGACTATGTGCCCTTTTTAGGAACGTAGCAACTTGGAAGAAAGCCAGGCATGTCCA
AGGTCTCTGGGGAACAAGGAATACTTGTTTCCTTTGCCCTCCTTTGGCAGCCTACATATA
TGCTTACTAAATTAGGGTTGATAGTGTCCTCTGATGGCTTTATTCTTTCTTGACCTAGGC
CAGAGGCATTGATGTGCAGCAGGTCTCCCTAGTCATCAATTATGACCTTCCCACCAACAG
GGAAAACTACATCCACAGGTATTTACCTGGTCTGACAGATCAAACACTCCCTGTGCTTAA
AAAAAAAAAAACACGTTCCTTTCCCCAACCTAACGCCTTTTTAAACTAACCTCCCCCCCC
CCCCCCCAGAATTGGTCGAGGTGGTCGGTTTGGCCGGAAAGGTGTGGCTATTAACATGGT
GACAGAAGAAGACAAGAGGACTCTTCGAGACATTGAGACTTTCTACAACACCTCCATTGA
AGAGATGCCCCTCAACGTTGCTGACCTCATTTGAGGGGCTGTCCTGCTACCTGGCCCTAG
CCCAGGGTTCAGTCCTGGGGGCAGGGCTGAGGAACAGCTGGAGGGGGGAGGGAAGGGAGC
CAAGGGATGGACATCTTGTTTTTGTTTTTTTGTTTTGTTTTTTTTTTCTCTCTCTCTCTC
TCTTTGAATAAATGTCACTTTTTGAGGCAAAAAGAAGGAACCGTGAACATTTTAGACACC
CTTTTCTTTGGGGTAGGCTCTGCCCCAGGCGCCGTCTCCTTCCCCCCCAAACACTAATGC
ATTTCCCTAACCTAATCACCTCATTCCTAAAGGCTTTCCTACCCCAGCCAAATCTCCAAA
AGTGAGTCAAGGGGCTAAAACATGGCTGGCCTCATTTGCTGGACCAAATCTACAGGGAGA
ACCCCCTGAATGAGGTTGTCCAGGGACTTGTCCCCAGGTGAGGGGAGCAGGGGAGAGAAA
ATGGTAGCCATTTTTACATTGTTTTGTATAGTATTTATTGATTCAGGAAACAAACACAAA
ATTCTGAATAAAATTACTTGGAAACTGCCTGTTTGGGCTTCTTGTTTCTTCCCTTCCCTC
TCCTGCAGTTACTAGTGTGGTTCAGCTGCCCCTGCACTAGTTCTTTCCTGAATTTGCCAT
GTTGCTTCCTGAAATACCAAATGACCCACACTACTGAAATTTGGTAGTGGGCTTTAGCAC
AAGACACAAGTGTCACTTGCTCCCAGTTTTGAAAAAGTAGTAATGGGTTCAAAGACTTCA
ACTGGGTGTTAGTCATAACCCAAATGTGGGTGCTAATTACCTTGGGTTCTGTAGCCCTTG
CTGTCCTGCGGTTATATAGGCCAAACTGGCCTTTTGGGTCTGCTTGCTGCCTTACAGTGC
TGGGATTGAAGCACATGGGTGAGGGTGAATTTCTTACCAATGAGGAAAAGGCTTCCTGTT
TGCCTGCTTTGTAAACTGCCAAGTAGAGCAAGTTTTGGCTTAGGTAAGTTCCGTGTGAGT
CAACTGCCTCATCCTCACATGGTAACTAAGACTACCGCCCACTGAGAAGGCCACTACCAA
TCAGTGCTTAATTGTGAAAACATTTAAATTACTTTAGCGGGTGGCTAGAGCTGAGGTGCC
TGAGTCAGGTTTGGGGTGGGATTACTTTGGTTAAGGGAAGTAAGAGTTTTCATTTCCTCT
TCCAAGAGAAGAGGGGATTGGGTTGAGGAAGGAGCTGTTACAGCCTAGCTGGACTCAGCA
GCTCTACCATGAGGTTCCCTGTGTGTCTGACCTTGCTGGTACTGCTTGTAGGTAAGGAGA
ATGGGAGGTGGGAGAGAGGGAGCTCCTGGGCAGGAGCCGGCACCTGGGTTATCAACTAAT
CTCTTAATGAAAGCCCAAGGAACAGGGAAAGACTGTCCTCACAAAAAGGCTGCTACTCTT
CTGCCATCCTTCACGGAGACACCTACAACCACCGGAAGCACAGCAAGCCCTACGACCACC
CACAGGCCCACCACAACCAGCCACAGGCCCACCACAACCAGCCACAGGCCCACCACCACC
AGCCACAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1037, 2314..2362, 2523..2655, 2997..3136, 4173..4341, 4663..4772, 4863..5006, 5083..5220, 5306..5395, 5638..5717, 5829..6508
1015..1037, 2314..2362, 2523..2655, 2997..3136, 4173..4341, 4663..4772, 4863..5006, 5083..5220, 5306..5395, 5638..5717, 5829..5970
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved