Rattus_norvegicus Locus Gnb2l1
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Gnb2l1
Rattus_norvegicus
Gnb2l1
10
SNORD95, SNORD95
1495..1561, 3540..3607
7370
TCCTTTTTAAAAAATATTTAAGCTGAGCAAGAGGAGCACGCATGGCAGAAAAGAAAATT
CCTGACTTCAACCTGTGCACTGTGACGATCACAAGCGCACTCACACACAAATAATTTTAA
GTTTTTTTTTCCTTTTTCTTTTTTTTTTTTTTAGGAGCTGGGGACCGAACCCAGGGCCTT
GTGCTTGCTAGGCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCCAATTTTAAAACG
TAAAGTTAAAATTTTTTGAGAGATCTGTGACATTTGGAGACACTAAATAATTCAAACAAG
TGTTGAGGGGAGGGTCATCAGGTTGCTAGATTATCAGTGTTCCTCTTCTTCCCTGTCCAG
GTTCACTTCTTTCAGGGCTACACAAGACGGACTAGCAGGCTTTTCTGAGGAGTGATCAGA
AGCACAGAAAGGGCTTCCAATCCCCATAAATCTTAACCCAGCACTTTCTCTATAGCCTCG
CCCGGCAGCGGCCCGGTTCTTGGGAGACAGAAGACATCCTTGGCAACATAGCCAGTTTAA
GACTAGCCTTCACTACATGAAACCTTGCCTTAAAACAAAAAAGGCCAAATTTCGTGGCAT
ACTCCTTTAACTGCAACTTTAATTGTACTTCCGTAAGTCAAAGTTAAAGCCGCGGTCTCC
AACCGAGAACTAAACACGAAGCGGAAAGGGCGGAGCTCCGTCAGTGCCACGTAGGGGCGG
TGAGCCGCTGTAGTTCGGTAATGTGCCGTTTAGCCTCACTTCTGCTTCCACGGCATGTTT
TAATCTTCCGAGAAGCCTTTCTAAAAACCTGGTGCACCTGGCTTCAGAATGCATTTGTAC
AGCGCTGCCTGTATGTTGCGTGGCAGAAGAAACGACGATACTGCGATCTACTTCTCCAGT
TCCTCCCACTTCATAGTGCAGCCATCTTTGGGCAGCAGTGAATCATGGGAATCCCCGCCT
TGCTCTCCGAGTATTTCCGGTTCCGGCGGAGGCCGCTCTTTCTTTTTCTCCGCAGGGTCG
CGGTGGCAGCCGCTGCGGTGCTTGGCTCCCTAAGCTATCCGGTGCCATCCTTGTCGCTGC
GGCGACACTCGCAACATCTGCAGCCATGACCGAGCAAATGACCCTTCGTGGGACCCTCAA
GGGCCATAATGGATGGGTTACACAGATCGCCACCACTCCGCAGTTCCCGGACATGATCCT
GTCGGCGTCTCGAGGTACGGGGCTGCATGCCGGGTGAAACACCCTGTGTCCTGGTGACTG
CATGTCTCGTGGCTAAGCAAGTGGCGCTCGTGTTGGCTGGCTCGGTCCGTTCCCCGACCC
AGGTGTGAGTTGGGGCGTGCAGACCCGAACATGGGCCCCAACCGGGGCGACCCTTTACAT
ATGAACGGAAACCGGGACTTGTCACGCAAGTGCACAGCATGGCGATTTTAATGCATCTCT
CGCTTGCTTTCTGGAGATGTGTTAACGAAGTAATTACGTGGCTACAAGCCAGGCGGAGCA
ATGATGACCCCAACATGCCATCTGAGTTGCTTTGCTGAAATCCAGAGGCTGTTTCTGAGC
TGCCACCGCCTGGCCCTGAACTCTAGGTGCCTTGTTCCCCAGAATTCCGGGCTTGCCCGT
CCTGCCCTAGATTTTCTTTCCTTGTAACTAATGCTATTTTTTCTTTCATGATATGTCTCC
ATGTATTTTTCCCTCTCAGGTCCTCCCTACTTGCCCAAAATTATGTTCGTCCTCTCTCTC
CTACCTAATTAATGCTAGGCTTATCGGGCTTTCTGTTGGTTTCTGTGTAAGTCGAAATGG
TCGTGGCTAGGACTGTGTATGATGCTGCCGTAACTGCTGCCTTTCTGTTAACTCTCCGAG
GCGGGAAAGTGTCTCTGCTCATCCTACACCCAAGTGACAGTGCTTTTGCTATTGAGTTAG
CCGCATCGATGGATAAGGCTAGAGTTTGAACACCATAGACACATATAGTGTGCGCGCGCG
TACACACACACACGTAGGGAGCCACATTAAATAAGTTTTTTTATGTTGAACTTAAATCTC
AACTCCAGGAAGTGTGTTGCCCATCATCTCAGATTACAGCTTAGATCTACGTCTCTGTGG
AATAGTGAGCCTCTTTTACTTCAAATTTGCCGTTTTTCTGCCATTTACCACACCAGTGAC
CTTAGGACTGTAACTTGTGCGTGGTAAGTAGTAGGTTTTGGGGGTCCTCATGAGATTTCT
TTACCAACCTTTTTAGACAAGACCATCATCATGTGGAAGCTGACCAGGGATGAGACCAAC
TACGGCATACCACAACGTGCTCTTCGAGGTCACTCCCACTTTGTTAGCGATGTTGTCATC
TCCTCTGATGGCCAGTTTGCCCTCTCAGGCTCCTGGGATGGAACCCTACGCCTCTGGGAT
CTCACAACGCAAGTAGCTGCTTTGGGGCCTTGGGGGAAGGTGGGCAAAAGTGAGGTAGAT
TCCCCAGGGTGTGGTCTTCCCTTGGTAATCAGTCCTTTTGTTTGAGGGAAGGCAACATTT
TGGGGTGTTAGGCTTCCCTTGGAGCTGCTTTTTTTTTTTTTAACTGGGTACCATGGGCTA
TTAAGTTGTCTCGGGTTGTAAGTTGTCTTAGATGGACATTGGCAGATGGACATTGGCAGA
TGTAATAGAGGATCCTAGTGATGACAAGGAGACATTGTCAACCAATCCCCACAAGGGAAT
GAGGACATGTCCTGCAATTCTGAATGGGTTCTCTGGTACATATCAGACATGGGCTAATAG
TAGGTTCTGAACCACTTGTGGACTGTGGAGTATAATAGAGCCTACAGGGTAAGGGTGGGG
CTAGGAAAAGGATCTAACTGGATGGGTGAAACCTGTCTAGAAAGTGACCAGGTTCTCCCT
CTTAGGGGCACTACCACGAGACGATTTGTCGGCCACACCAAGGATGTGCTGAGCGTGGCT
TTCTCCTCTGACAACCGGCAGATTGTCTCTGGGTCCCGAGACAAGACCATTAAGTTATGG
AATACTCTGGGTGTCTGCAAGTACACTGTCCAGGTAAAGGGGTAAGGGTGGTAGGGACGG
CGTCCAGGGCTGTCTCCCACCCCCTGGGGGCTGTTTTTAGGGTGCGTTCATCACTGTGTG
GTCCTGGTGGCCTCAGGTGATCTGATTCCTAGGTGTGTACTACTACCACCTGGCACTTTC
TCTTGTGTATTGTTAGCCCTGTCTGGGATTTTGTTTTTAAACTTTGTGTGCCTGCTACCT
TGTGACTGGACTGGCATGGGGCTCAGAGGAGTTGGAGGGATTGTTTGTTTGTGGGTTTCT
GTGTAGGTAGACCTGCATGAGATCATGTGCTTCCAGACTGCTGGGGTTAAAAGGCCTTCT
TTTCCCCCTTTAATCCCATATTAGGTTGAGCTGTGGAAACCCAAACCACGGCATCAGTTG
GGCAGGGTCTTGGCACATGAGCAGATACCCAGATGTCTCTCATAACTGCCCTAAGGTTTA
AATGATCTTAAGTCTCTCACCTATCTCCTAGAGATGTGTTTGAGGGGTTACAAGCCAGGC
CCAACAGTGATGACCACAACATGCCATCTGAGTTGCTTTGCTGAAATCCAGAGGCTGTTT
CTGAGCTGTGCCTGGTCCTGTGCTCCATGAGTAATGAGTGGGTGAGCTCTGGGGTCACCT
TAGGACTCAAATGTCAGCAGGCTTGACAGGTGGCTTTGCCCCTGGTCTGTTGGCCTAAAG
ATTGTGCTTCTGAGAAGGGAGTGCAGGAGTGCCGTTGCCCCTCTTAGGGAAGTGTAGTAG
AGATCTGTAATCTGGGAAAAGCTGCCGCCTCTTTTTTTTTTTTAAAGATCCATTCATTTA
TTATATATAAGTACACTGTAGCTGTCCTCAGACACACCAGAAGAGGGCATCGGATCTCTT
TACAGATAAGCTGCCGCCTCTTAACCTTCCCCTGCATCTTTGTAGGATGAGAGTCATTCA
GAATGGGTGTCTTGTGTCCGCTTCTCCCCGAACAGCAGCAACCCTATCATCGTCTCCTGC
GGATGGGACAAGCTGGTCAAGGTATGCTTGCAAGGGAAATACGTTGCCATTCCTCTCGGG
GAATAATGCGTTCTGACTTGGGATATTCTGAAGATTAGTTTGGCTGTGGCTTTTGGTGGT
TGATCTCAATACTTTAGGGATGTGGTTTGTTTTTGAGGCCTGGTTTCATTCTGTATCCCT
TACTGGCCTGCCATCCAAACAATCTCAGTCATTGAAGTATTGGGACTGTATAGGCCTGCA
CAGCATGCCTGTTGAGTGATCCCTGTACCCTTCTTGTTGAGTGTAGACCTTTGTCCTGGT
CACCCACGGAGTCCTGTTTTGTAGGTGTGGAATCTGGCTAACTGCAAGCTAAAGACCAAC
CACATTGGCCACACTGGCTATCTGAACACAGTGACTGTCTCTCCAGATGGATCCCTCTGT
GCTTCTGGAGGCAAGGTATTTGGGGCTTGTCCTCTCCTTTCCAGAGGCTTTTCTCTGGTA
GCATGCACTAAAGTGGGAAAGTTTCTAAGTACTACCTTGAAATATGTAGAAAAGTATATT
AAAGATGATTGCTTTTTAAGTTGGGGTTTTGGCACAGAAAGGTATCGTGCATTAGAAGAA
AGGACTTAGAGCCATGAACACTATACCTAACTCAACCTTTTCTATCTGCCCAGGATGGCC
AGGCTATGCTGTGGGATCTCAATGAAGGCAAGCACCTTTACACATTAGATGGTGGAGACA
TCATCAATGCCTTGTGCTTCAGCCCCAACCGCTACTGGCTCTGTGCTGCCACTGGCCCCA
GTATCAAGATCTGGGTAAGTGGTCTGTTGCGCATAGTCATTGACTTGACTAGTAGAAATC
AACCTTTCTCAGATACCATCTTTAGGTTGCTATCAGCACCCCCCTTAACAGTTTGCAACA
ATGGCTGACATCTGCCTAATGAAAAGTAATGCCCATGTATAGCAGCAGTTTATTGAGTGT
TCTAATTGCCATTTGGGCCAAGGTAATTCTCTTGTGAGAGGCTTTTTTGACAGTGCAGGT
GGCATCTAGCCACCAGATAATTAGGAGTTAAGCAGCTGCCATAAATCATGAAGGCAACAA
GTGTAGAGCATTGTATGCAGTAGAGCATCCAAATTCAATTCCTCGCAACATTTTAGAAAA
GTCCTTCCTGTGCTGCTAAGTATCCACTTGGATTCAATTCTGTAATCTTTGTCACAGGAT
TTCTAAACTAAAAGACAAGTTCATACTGTGTAGACTGGCCTCAGGGAGATCACAGATAAT
AGCCTGCCTCTTAATCTCCTGAGGGTAGAATTAAGAGTATGCACTACTATATTGAACTGT
TGGTAGTGTGTATAAATAGCATTTAACTTTAACTGTTTTGAATCCCTTTTGATTTTGCGC
CTTACACATTGGTAGCCTTTCCAAGGTAAAAGTGGCACCCTTTTTAGTTGGTAAAGCACA
TTTTTGTTGGTGGATGGGTGGTGCACACCTATTTAAAGAGAAGTCATTTGCAGTAAGTTG
GCAATCTTGCCTCAATCTCCCAGGTAGCTCAGATTATAAGCCTGAGTCATCAGGACCTGA
TGATTGATTTTTGCTAGTGGAGTATAGGGCCAATACTCAATATATCCTTGAAAGAAAAAT
AACCCTTTTAGACAGAAATCTGAGTTGTAAACTTTAAAAAAAAAAGTTCGTTGTCTGGTT
ATATACATGTGAGTCCCAGCTAGCCTGCCCATAGGCAAATTTTTCTCAGTTGTTTCTGGG
TGAAACTTAAGTTGCCAAGCAAGGAGCTTTCCCATGGAATGCCATCTTGCTAGTTCTATT
GAAACGATTCTAAGAGTTGTTATTTGAGTAGTGGGTGTCCTTATGGGTTTTGGTCTGTTC
CTCAGGACTTGGAGGGCAAGATCATTGTAGATGAACTGAAGCAAGAGGTTATCAGCACCA
GCAGCAAGGCAGAGCCACCCCAGTGTACCTCTTTGGCTTGGTCTGCTGATGGCCAGGTAA
GTGTATTTGGCCCTTCAGCTCAGTTCCCCAGCTTGTCTCCCTTTTTCTTAAGTTTAGGCA
CAAAACTAAGGTCAACATAAAATGAAATCAAATCAGGTTAATTTAGGATGGGAAAAGATT
ATGGTAATGGAGTTTTTAAACCTGGAAGCTTAAAAATGTCTGAATGTGTAGCAAGCTGCT
TTTAACATGAAAGAGGGGCCCTAAATTCTTTGGACTACAGAGTTCATTGCTGGGTGCGAC
ATGACCCTGTTGTTGTTTTCTTACAGACTCTGTTTGCTGGCTATACCGACAACTTGGTGC
GTGTATGGCAGGTGACTATTGGTACCCGCTAAAAGTTTATGACAGACTCTTAGAAATAAA
CTGGCTTTCTGAAATTGGCCTCTATATGTGAGTCCTGGGAGCTGAGCCCTGTTTTACAAG
AGCACCCCATGCTCTGAACCACTGAAACATCTTTTGAGATTGGGTCTTGAAAGAAATGAG
TAAACACATCAGCTGTCCATATCACTAATAGGTAAAAATCAACTTGGTCTTCTGTAATTC
TGGAAGTTTTTATTTTTTTTTTTACTAATTCTAGTGGGTAGGCCTCATCACCTCATATTC
ATATGCAAACATAGCAATTCAGAGCAGACCTGGAACCTCAATCCCAGGCTGCTGATAACC
AGAAACCTGATCCTGAATGGAGCAAGTGTGAAAACCTGAGCTGGTTCTGCATGTTGCAAG
GCAAAATGCACTTAGAGACAGTTCTATCAGAAAACATAGAGTCCACAAAAGAAGCAAATA
AACACTTTTTTTATTTTTTGCAATACAACCCACTTTCCCTCCCCAAGAACATGGACTGAC
CTCAGCCACCAAAGCAGAGGACAAAAGCTGTTGCTGTGTCAGAAGGCAAGGGGTTACTAG
AAAAATAGATTATACCCAACAGTCTCCCAAGGATCCAGACCCCTGTCCCGAGCTCCCCTA
ACAGGGCTAACCACATGTAACTAAAAGGCATGGAGAGGCCAGAAACCTCACTGAAAAGGG
AAGAGAGCCTGGCAGTGAAGACTTGGGCTCCTACCTAACGAAAAAAACTAAGATGCACAG
AGAAAATAATTTATTGGGTAATGGTAGAGATGTCATGCTGACCATTCCAGATCTCACTGA
AGCTAAATTCTGGCCAGTCTATGGAGGTAGAAATTGGGGGTGGAAGGAAAGCTTAAGAAT
TCCTACTTCCCCAAGAAAAGTAGACTTTACACAGCACTACCCTTTTGCCCAGTCTGACTT
CCCACAGAGCCTCTAAAACTTAGCTGGTCTGCACCAAAACATGGGAGTGTTTTGCCCAAA
CCCTCCAGCCTCAGAAATGACGGGTTGAGTAGGGGTGGAAAAGGTTGCATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1213, 2236..2411, 2671..2675, 2885..3032, 3945..4040, 4344..4454, 4673..4813, 5885..5995, 6266..6370
1105..1213, 2236..2411, 2671..2675, 2885..3032, 3945..4040, 4344..4454, 4673..4813, 5885..5995, 6266..6328
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved