Rattus_norvegicus Locus Rps2
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rps2
Rattus_norvegicus
Rps2
10
SNORA64
1834..1967
3835
tacagtgtacttatatataataaatctttaaaaaagaaaaacccgttcttatgggagtc
agttacaccaagtgatgtacattcacgcaagcaaaacaaagcacattaaaacgcacaaga
atccgcctgccttgggtacccagatgctgactgctgagactaacacaccggttgagaatg
cactttccggggttggggatttagctcagtggtagagcgcttgcctagcaaccgcaaggc
cctgggttcggtccccagttccgaaaaaaaaaaaaagaaaaaagagaatgcactttccac
ctagactgatggtaaccgtccaacacattaatacacagttaagttaaaacattttatttg
agaaaagaggacatccgaaccctgtcattctcgcgggagagtcagcggcaacgtccagat
ccggtggaattaactcattttgagaaaagaggacacccgaacactgccactcttgcgggg
gaggcggcgacaacgttcagatccagtggaacctgtgaaataaatgacgtgattaggact
gtggccccaagccagaccgcgggagcggcgaggcgatctggaatgtaggggcctgggttt
caccctcccacactggggcagcagggggtgagctgaggcctctgtggctctgggcgccga
ttctcaaccccggccacaggccaaagccgaggatgattttcaacgaacgcccatttactg
ggtcaaagcccatcaggagcgacctacctggacatgaaaacggaagcacgaactcgtgga
cactaggaagaccacaaagcgccggcgcgagtatttatatacgcgcttccggctggtggc
gttcgcggcttcggcgaggggaagtgcgcaggcgcaagtagaccgtggcggaggcgggac
aagacgcagccaatcacagcctgcagttgccctgtatagacgttcgagatctcgcggctc
ttggctcgctataaaaggtcccttccgcagcgcctccctctTCTTTTTCTTCGGGAAAAC
ACgtgagtctgtgttactgggctctgatcttgcggcctgggctgtgggaatccgtggaca
tccggacggacacagctttggcagctccgcggaccctggggttctactgatttgcttttt
cttctcttgtcactagCAAATGGCGGATGACGCCGGTGCAGCGGGAGGGCCCGGAGGACC
CGGGGGCCCAGGATTAGGAGGCCGCGGCGGCTTCCGCGGAGGATTCGGCAGCGGCCTTAG
GGGCCGCGGTCGTGGCCGAGGCCGTGGCCGCGGTCGAGGCCGCGGGGCTCGTGGAGGTAA
AGCTGAAGACAAGGAGgtaggtgtgggccgctggcggagcgggctgctcaccctctgcac
ggagatgcagccctttgactgatctcttccttcagTGGATCCCCGTTACCAAGCTGGGCC
GCCTGGTTAAGGACATGAAGATCAAGTCCTTGGAGGAGATCTACCTGTTCTCCCTGCCCA
TTAAGgtacaaagatgagtccgtgcataaacaactcaagggcgggaatatctagatggct
ctaagtgtgctgccacattttattgtcaagggtggaggaggattggaatacccttctttg
tccattggtagggagcgaatttaatgtatttgccataaaatctcttttacagGAGTCTGA
GATTATTGACTTTTTCCTGGGTGCATCTCTAAAGGATGAAGTTCTGAAAATCATGCCAGT
GCAGAAGCAGACTCGGGCTGGCCAGCGGACCAGGTTCAAGgttagttaggatcgtttctt
ggcaagagccgtttgaacagtagggctgtacttaactctctcactctgcatggttacact
aggctttacccgtgtgactttcgtaccgggagagagagaaaaggagttcctccagtactt
gggattggcctcacagtggcctttcttgcttagaggagcaccacaggtcctgtttgggat
gtgctggtggcatgaggtatctacagccatttcacttaagtcttttcacagGCCTTTGTC
GCTATTGGGGACTACAATGGCCACGTTGGTCTTGGTGTTAAGTGCTCCAAGGAGGTAGCC
ACTGCCATCCGAGGGGCCATCATCCTGGCCAAGCTTTCGATCGTCCCAGTGCGGAGAGGC
TACTGGGGGAACAAGATTGGCAAGCCCCACACTGTGCCATGCAAGGTGACAGGCCGCTGT
GGCTCTGTGCTGGTTCGTCTCATCCCTGCCCCCAGAGGCACTGGCATTGTCTCTGCTCCT
GTGCCCAAGAAGCTACTGATGATGGCCGGTATAGATGACTGCTACACTTCAGCCAGGGGC
TGCACTGCCACCCTGGGCAACTTTGgtaggtagctcatttattgtggcctctcttcagct
gttttaatcttaaaaaaaaaaagacaaaaccaactcttttactgtttcacagCCAAGGCC
ACCTTTGATGCCATCTCCAAGACCTACAGCTACCTGACCCCTGACCTCTGGAAAGAGACT
GTGTTCACCAAGTCTCCTTATCAGgtaggctgattcagatggtggtgtgttggggattta
gctcagtggtagagcgcttgcctaggaagcgcaaggccctgggttcggtccccagctccg
gaaaaaaaaaaaagaaccagatggtggtgtgtttagctgccttaagctttgttgcctgag
ttgggggcatgttgtatactaatgtccttctctttttagGAATTCACTGACCATCTTGTG
AAAACCCACACCAGAGTCTCTGTTCAGAGGACCCAGGCTCCAGCTGTGGCTACCACATAA
GGGTTTTTATACAAGAaaaataaatgaattaagtctgttaattgtgtttttccttttgtc
tgtctcccccatacctggaactacacagctctggctggctcaaaatgagcccaactaagc
ggctgtgcaacttagacacagagacacaggtgatggccaggcctgtcattttatttcagc
agtggatgaacaagagttctttgtctggtgtcttaggcggcagcagtctccttggcagcc
tttctctcttccagcatcctctgcttctgctttgccaggcacttcctggcagaatagtag
gctcccaggtcctggtctggaggagagatgggccatggagagcttgttataggcaggttt
tagtaacgcgggaaacaaggacccaaaactgatcatacagctgaaagggtggggaaagcc
acaaggtaaaagggtcactcacagcggtcctggtaggctttagacacttgggtgaattgc
tccaattccttggcacagttctgcagtgcactctctccttccctctgctgacaagcctta
agtctctcctggatgatgttgatgatttcttggtccactttgctgaaagagtaggagtct
agctcaaaaatttggaaggatagattacctcagcctggaatctgggtccacctcaggagg
tgtgggggtatgatacccagtgttccctgctgttcacttacaagtcccttctccactgca
tctcagcctcatagatacagatgacatcaccctctttgcattccgtgatgtctggcactc
gacggtactgtcggtggtagtagtaggttcggttcttggcgtgctgttgttcaatgaact
ctggaaagagaataccttgacctcaatggcccgtcagcttaagcagcttggggctaaggg
gtctgaggctccaagctgttacagaaccagttttatgaaaggctggcaacagtggttgtc
actaccttcaattacaagagaacataattggtcccacctaccccgtgggggtgggg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1156..1335, 1415..1504, 1672..1779, 2031..2364, 2452..2543, 2739..2835
1159..1335, 1415..1504, 1672..1779, 2031..2364, 2452..2543, 2739..2819
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved